Biomédica 2017;37:191-9

http://dx.doi.org/10.7705/biomedica.v37i2.3007

ARTÍCULO ORIGINAL

Frecuencia de mutaciones de la nitrorreductasa RdxA de Helicobacter pylori para la activación del metronidazol en una población del departamento del Cauca, Colombia

Claudia Patricia Acosta1,2, Andrés Javier Quiroga1,2, Carlos H. Sierra-Torres1,2, Alba Alicia Trespalacios3

1 Grupo de Investigación en Genética Humana Aplicada, Facultad de Ciencias de la Salud, Universidad del Cauca, Popayán, Colombia

2 Fundación InnovaGen, Popayán, Colombia

3 Grupo de Enfermedades Infecciosas, Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá, D.C., Colombia

Contribución de los autores:

Claudia Patricia Acosta: coordinación general de actividades, supervisión metodológica y análisis de secuencias

Andrés Javier Quiroga: ejecución de pruebas moleculares y análisis de secuencias

Carlos H. Sierra-Torres: análisis de resultados

Alba Alicia Trespalacios: análisis de resultados y análisis de secuencias

Todos los autores participaron en la escritura del manuscrito.

Recibido: 06/08/15; aceptado: 04/08/16


Introducción. La resistencia al metronidazol es un factor clave relacionado con el fracaso del tratamiento contra la infección por Helicobacter pylori asociada, principalmente, con mutaciones en la nitrorreductasa RdxA. A pesar de su importancia, los estudios sobre esta proteína son aún incipientes en Popayán, Colombia.

Objetivo. Evaluar la frecuencia de las mutaciones en la nitrorreductasa RdxA en una población de pacientes con enfermedad gastrointestinal por H. pylori.

Materiales y métodos. El ADN de 170 biopsias gástricas se amplificó mediante reacción en cadena de la polimerasa (PCR) para detectar las mutaciones en la nitrorreductasa RdxA. Se analizaron las secuencias traducidas a aminoácidos y se compararon con la cepa de referencia 26695.

Resultados. La frecuencia de mutaciones de la nitrorreductasa RdxA en la población de estudio fue de 78 %. Su distribución más frecuente se detectó en las posiciones D59N (en 153 muestras), R131K (en 101 muestras), R90K (en 97 muestras), A118T (en 42 muestras), I160F (en 32 muestras), H97T (en 26 muestras) y en los codones de parada Q50*; D59*; E75*; C159* y I160* en cinco, una, tres, diez y seis muestras, respectivamente. El genotipo de virulencia más frecuente fue el vacAs1/m1 negativo para cagA (48,6 %).

Conclusiones. La gran frecuencia de mutaciones en la nitrorreductasa RdxA en aislamientos de H. pylori en Popayán sugiere que los tratamientos empíricos con metronidazol no serían una opción válida para su erradicación en pacientes de la población estudiada.

Palabras clave: Helicobacter pylori; mutación; nitrorreductasas; metronidazol; Colombia. http://dx.doi.org/10.7705/biomedica.v37i2.3007


Frequency of Helicobacter pylori nitroreductase RdxA mutations for metronidazole activation in a population in the Cauca Department, Colombia

Introduction: Resistance to metronidazole is a key factor associated with Helicobacter pylori treatment failure. Even though resistance is mostly associated with RdxA nitroreductase mutations, studies of this H. pylori protein in Popayán (Colombia) are still incipient.

Objective: To evaluate the frequency of mutations in the RdxA nitroreductase in a population of patients with H. pylori-positive gastrointestinal disease.

Materials and methods: We amplified the DNA of 170 gastric biopsies by PCR to detect mutations in the RdxA nitroreductase. An analysis of DNA sequences translated into amino acid sequences was done and then compared to the reference strain 26695.

Results: The frequency of RdxA nitroreductase mutations in this study population was 78%. Its most frequent distribution was found in positions D59N (153 samples), R131K (101 samples), R90K (97 samples), A118T (42 samples), I160F (32 samples) and H97T (26 samples), and meaningful stop codons Q50*, D59*; E75*, C159* and I160* in five, one, three, ten and six samples, respectively. The most common virulence genotype was vacAs1/m1 cagA negative (48.6 %).

Conclusions: The high frequency of RdxA nitroreductase mutations in H. pylori isolates in Popayán (Colombia) indicates that empirical therapy with metronidazole may not be a valid option for the eradication of H. pylori in patients of the studied population.

Key words: Helicobacter pylori; mutations; nitroreductases; metronidazole; Colombia. doi: http://dx.doi.org/10.7705/biomedica.v37i2.3007


Las nitrorreductasas son un grupo de enzimas que catalizan la reducción de grupos nitro de compuestos estructuralmente diversos que incluyen los nitrotoluenos, los nitrofuranos y los nitroimidazoles. Estas enzimas se pueden subdividir en dos clases generales: sensibles al oxígeno e insensibles al oxígeno (1).

En Helicobacter pylori, bacteria que infecta a los seres humanos y se asocia con el desarrollo de gastritis, úlcera péptica, linfoma gástrico de tejido linfoide asociado a mucosa (Mucosa-Associated Lymphoid Tissue, MALT) y cáncer gástrico (2,3), la nitrorreductasa RdxA insensible al oxígeno cataliza la reducción del medicamento antimicrobiano metronidazol y genera productos intermedios y finales, como la hidroxilamina y el peróxido de hidrógeno, y radicales libres de oxígeno que producen daño en el ADN y la muerte celular del microorganismo (1).

Esta nitrorreductasa es esencial para la activación del metronidazol en H. pylori (4), el cual se considera un antimicrobiano efectivo contra organismos con poca reacción de oxidorreducción (redox) intracelular, como las bacterias anaerobias, los pro tozoos y los microrganismos microaerófilos, entre ellos, H. pylori (5).

Uno de los medicamentos utilizados en los esquemas de tratamiento para la erradicación de esta infección es el metronidazol; sin embargo, la aparición de aislamientos que no responden al medicamento ha fomentado el interés en las investigaciones para comprender las causas principales de la resistencia de la bacteria a su acción (4-6).

En varias revisiones sistemáticas se ha reportado una gran heterogeneidad en las frecuencias de prevalencia de la resistencia primaria al metronidazol en los países latinoamericanos, y cabe resaltar que Colombia presenta la tasa de resistencia más alta, 83 % (7,8).

Los resultados de diversos estudios han demostrado que la resistencia de H. pylori al metronidazol se debe a la presencia de diferentes mutaciones en el gen rdxA, las cuales se evidencian como inserciones o deleciones en diferentes sitios del gen. Estos cambios en la secuencia del genoma llevan a que la nitrorreductasa RdxA codificada por el gen se inactive y no logre reducir el metronidazol a nivel celular, generando así la resistencia de la bacteria al antimicrobiano (4,9,10). Las mutaciones que inactivan el gen rdxA originan codones de parada o sustituciones que tornan disfuncional la proteína. En algunos casos, el gen frxA promueve la aparición de resistencia y en otros muta con el gen rdxA (9,11).

La participación del gen rdxA en el desarrollo de la resistencia al metronidazol se ha estudiado mediante modelos en ratones para determinar su secuencia en cepas sensibles y resistentes al medicamento. Se ha encontrado que las cepas resistentes presentan mutaciones por el cambio en el marco de lectura resultado de la pérdida o ganancia de adenina (A) o de timina (T), mutaciones de sentido erróneo que contienen la sustitución de aminoácidos como la prolina (P) por la leucina (L), la tirosina (Y) por la histidina (H) y la alanina (A) por la valina (V) (12,13). Aldana, et al. (9), utilizaron muestras de pacientes sometidos a endoscopia, cultivadas y posteriormente inducidas a resistencia al someterlas a diversas concentraciones de metronidazol. En los análisis de la secuencia del gen rdxA, se han encontrado sustituciones de aminoácidos, como el cambio de serina (S) por asparagina (N).

Según las recomendaciones del Consenso de Maastricht IV (14,15), la secuenciación es una técnica utilizada con éxito en la determinación de mutaciones, en especial en áreas geográficas donde los cultivos de la bacteria no están disponibles. El uso de los tratamientos de erradicación de la infección debe basarse en estudios de prevalencia de la resistencia a los antimicrobianos en cada región (2,7).

Puesto que en Colombia son pocos los estudios en que se ha determinado la presencia de mutacio nes en la nitrorreductasa RdxA y, dado que en el departamento del Cauca no existe un laboratorio con la infraestructura para cultivar H. pylori, el objetivo de este estudio fue determinar la frecuencia de mutaciones de RdxA y describir los cambios que, según los reportado en varios estudios, estarían asociados con la resistencia al metronidazol.

Materiales y métodos

Población de estudio

Se incluyeron 170 pacientes remitidos a las unidades de gastroenterología del Hospital Universitario San José y el Susana López de Valencia, y a la Unidad ENDOVIDEO 2000 (29, 40 y 101, respectivamente) de Popayán, entre octubre de 2011 y junio de 2013.

Los criterios de inclusión fueron los siguientes: pacientes mayores de 18 años, nacidos en el departamento del Cauca, con síntomas de dis pepsia, y que no hubieran recibido tratamiento de erradicación de H. pylori, ni antibióticos ni sales de bismuto durante el último año.

Los pacientes aceptaron su participación en el estudio mediante la firma de un consentimiento informado, según lo dispuesto en la Resolución N° 008430 de 1993 del Ministerio de Salud. Esta investigación fue aprobada por los comités de ética de la Universidad del Cauca y de la Pontificia Universidad Javeriana. Los participantes respondieron un cuestionario estandarizado sobre algunas variables sociodemográficas y clínicas.

Se tomaron ocho biopsias de cada paciente: tres del antro, tres del cuerpo y dos de la incisura angular, según los criterios de Sydney (16). Para el análisis histopatológico, se utilizaron dos biopsias de antro y cuerpo, y una de incisura, todas examinadas por un único patólogo experto, siguiendo los cri terios establecidos internacionalmente (17). Las biopsias restantes se utilizaron para la extracción del ADN.

Extracción del ADN y amplificación mediantePCR

Las muestras de las biopsias gástricas (antro, incisura y cuerpo) de cada paciente se colocaron en recipientes independientes y se transportaron en medio de cultivo de caldo de Brucella spp. con 20 % de glicerol para la extracción genómica, usando el estuche Wizard Genomic DNA Purification® (Promega, Madison, WI, USA) de acuerdo con las recomendaciones del fabricante. El ADN se reconstituyó en 100 µl de solución de rehidratación y se almacenó a -30 °C hasta su uso.

La calidad del ADN se determinó estableciendo la relación de absorbancia A260/A280 con un espec trofotómetro Thermo Scientific NanoDrop 2000™.

La presencia de H. pylori se determinó por los alelos s y m del gen vacA, según la metodología descrita previamente (18). Se utilizó una prueba de PCR múltiplex (Qiagen Multiplex PCR®) para amplificar los genes vacA y cagA, con las siguientes secuencias de cebadores: vacA s F 5’ – ATGGAAATACAACAAACACAC – 3’; R 5’ CTGCTTGAATGCGCCAAAC – 3’; vacA m F 5’ CAA TCT GTC CAA TCA AGC GAG – 3’; R 5’ GCG TCT AAA TAA TTC CAA GG – 3’ y cagA F5’GTTGATAACGCTGTCGCTTC-3’, R 5-GGGTT GTATGATATTTTCCATAA’3’. La reacción incluyó una mezcla de 2 µl de ADN genómico bacteriano, 1X de Qiagen Master Mix®, 0,3 pmol/µl de cada cebador, y 2 µl de agua libre de ARNasa en un volumen de 12 µl de reacción.

Los productos de amplificación se evidenciaron en geles de agarosa al 1,5 % por tinción con bromuro de etidio bajo luz ultravioleta, tomando como referencia las bandas de amplificación de las cepas NCTC 11637 (genotipo: cagA, vacA s1/m1) y 3062 (genotipo: cagA negativo, vacA s2/m2) de H. pylori.

Análisis del gen rdxA

Se amplificó una región de 460 pb del gen rdxA en las muestras positivas para H. pylori determinadas por histopatología y mediante la genotipificación del gen vacA. Se usaron los iniciadores rdxA F 5’- GACAATTATTAAACGAGCGC-3’ y rdxA R 5’- CCTCCAATAATGCAACTATC-3’ correspondientes a las posiciones 1013697 a 1014157 de la cepa de referencia 26695 (acceso en Genbank: gb| CP003904.1) (19), reportados por Kwon, et al. (20).

Para la PCR, se usó una mezcla con 2,7 U de Taq ADN polimerasa recombinante (Invitrogen™, Brasil), 5 µl de ADN genómico bacteriano, 0,5 pmol/µl de cada cebador, 1,0X de solución tampón de reacción proporcionada por el fabricante (Invitrogen™, Brasil), 2 mmol/L de MgCl , y 0,5 mmol/L de cada deoxinucleótidotrifosfato (dNTP) (Amersham Pharmacia Biotech, Inc.) en un volumen final de 50 µl de reacción.

Las muestras fueron llevadas al termociclador (MyCycler Termal Cycler™, BIORAD) bajo las siguientes condiciones: desnaturalización inicial durante 9 minutos a 95 °C, 40 ciclos de desnaturalización a 95 °C durante 30 segundos, hibridación a 50 °C durante 45 segundos, extensión a 72 °C durante 45 segundos, y una extensión final a 72 °C durante 5 minutos.

Los productos de amplificación de 460 pb se evidenciaron en geles de agarosa al 2 % por tinción con bromuro de etidio bajo luz ultravioleta y por comparación con la banda de amplificación de la cepa de H. pylori NCTC 11638.

Los productos de la PCR se enviaron a Macrogen® Inc. Company (Corea) para el análisis de secuencia ción del gen rdxA. Posteriormente, las secuencias obtenidas se evaluaron usando la herramienta BLASTx (Basic Local Alignment Search Tool) (21). Para determinar los cambios de la nitrorreductasa RdxA, se comparó con la región amplificada de la cepa de referencia 26695 (Genbank HP26695 ) (22) sensible al metronidazol según estudios previos (23). Además, se compararon con las secuencias de las cepas 11638 (identificación de la secuencia: emb|CAC83809.1| y gi|9858509|gb|AF180408.1|). Los cambios reportados fueron relacionados luego con los codones de parada y las mutaciones de cambio de aminoácidos. Se utilizó el programa CLUSTAL W (24) para el análisis de los cambios más significativos en la nitrorreductasa RdxA.

Análisis estadístico

Para el análisis estadístico se utilizó el programa SPSS®, versión 19.0 (IBM SPSS Inc., Chicago, IL, USA), y se hizo la prueba de ji al cuadrado, con un valor de significación estadística de p<0,05.

Resultados

Características sociodemográficas de la población

Se incluyeron 170 pacientes diagnosticados por histopatología con infección por H. pylori, y muestras sometidas a genotipificación y análisis del gen rdxA. La distribución de las características de sexo, edad, procedencia y escolaridad de los participantes se muestra en el cuadro 1. La edad de la población de estudio fluctuaba entre los 18 y los 84 años, y la edad promedio fue de 51 ± 13,6 años; la mayoría eran mujeres (103, 60,6 %). El 51 % de la población provenía del área rural y el 62 % tenía un nivel educativo menor o igual a primaria.

Se hizo la genotipificación de todas las muestras y el genotipo más frecuente en esta población fue el vacA s1/m1 negativo para cagA (49,4 %), seguido por el genotipo vacA s1/m1 positivo para cagA (39,7 %), otros genotipos s2/m2 negativos para cagA (5,3 %), el s1m2 negativo para cagA (1,8 %), y el s1m2 positivo para cagA (0,6 %); en 3,2 % de los pacientes se detectaron infecciones múltiples.

Análisis de secuencia de la proteína RdxA

En 92,9 % de las secuencias de la proteína RdxA se detectaron cambios en, al menos, un aminoácido en comparación con la cepa de referencia 26695. En el cuadro 2 se presentan todas las mutaciones distribuidas en codones de parada y mutaciones puntuales desde la posición 46 hasta la posición 160 de la proteína RdxA. Por otra parte, el 78,2 % de las muestras presentó mutaciones relacionadas con la resistencia a metronidazol (49,10,13,22, 25), específicamente mutaciones puntuales tales como R131K (en 101 muestras), R90K (en 97 muestras), en A118T (en 42 muestras), H97T (en 26 muestras), E133K (en 11 muestras), y S108A (en 9 muestras), en tanto que el 21,8 % de las mutaciones puntuales no habían sido reportadas en aislamientos resistentes: la D59N (en 153 muestras), la G98S (en 27 muestras), la H97Y (en 18 muestras), la A118S (en 5 muestras) y la I160F (en 32 muestras) (4,6,12,22,26). Se encontraron, además, mutaciones relacionadas con los siguien tes codones de parada: Q50*(en cinco muestras); I160* en seis muestras, E75* en tres, C159* en diez, y en la posición I62* en dos muestras.

En la figura 1 se observan los tres sitios con mayor variabilidad en la proteína RdxA (R90, H97, R131), así como los codones de terminación en las posiciones 50, 78 y 102. En la posición 133, se encontró una doble sustitución asociada a un cambio en el marco de lectura. En el cuadro 3 se relacionan las mutaciones de inserción en las posiciones Q50*, D59* y E74*, y de sustitución en las posiciones E75*, K78*, N103* y C159*, las cuales generaron codones de terminación y posibles interrupciones del marco abierto de lectura.

Por otro lado, se compararon los tipos de mutaciones distribuidos en las lesiones gástricas (cuadro 4) en las que fueron más frecuentes las mutaciones puntuales en las diferentes enfermedades gástricas, aunque no se registraron diferencias estadísticamente significativas (p=0,74) en comparación con las mutaciones en los codones de parada.

Discusión

La resistencia de H. pylori al metronidazol se ha atribuido a la inhibición de la actividad de las nitrorreductasas, especialmente por mutaciones en el gen rdxA, las cuales se relacionan con la estabilidad de la proteína, en tanto que la dimerización y la actividad enzimática dependen de la unión al cofactor fosfato de lactoflavina (FMN) (1,5). Las mutaciones que afectan las posiciones A68V, A118T, R90K, R131K, R16H, S88P y H97T, y las que introducen un codón de parada, como N73* y Q50*, se han correlacionado con la resistencia al metronidazol, especialmente cuando hay valores altos en las concentraciones inhibitorias mínimas (CIM) (13,20,27) y cuando la CIM por dilución en agar es igual o superior a 12 µg/ml (13,22,25).

Dichos resultados coinciden con los hallazgos del presente estudio, en el cual las mutaciones R90K, R131K, D59N y H97T fueron las más representativas, en tanto que las más frecuentes fueron la D59N (153/170), seguida por la R131K (101/170), la R90K (97/170), y la A118T (42/170). Mendz, et al., reportaron una compilación de mutaciones en RdxA, incluidas aquellas que representan pérdida de la función de la proteína(4), datos que coinciden con los encontrados en este estudio, especialmente en cuanto a las mutaciones en las posiciones 56, 59, 90, 97, y 118, en las cuales se han documentado cambios en los diferentes aislamientos.

Las mutaciones H53R, M56I, L62V, A68V,H97T y G98S halladas en este estudio concuerdan con lo reportado en otros estudios en aislamientos resistentes al metronidazol (12,13,22); sin embargo, los aislamientos sensibles también han presentado estas mutaciones, lo cual confirmaría las limitaciones del empleo de las mutaciones en RdxA como único marcador de resistencia al metronidazol en H. pylori (22). Por ello, se necesitan estudios posteriores de transformación con cepas resistentes y sensibles, para avanzar en la comprensión del papel del gen rdxA en la resistencia a este medicamento (27).

Se ha reportado que las sustituciones e inserciones que causan un codón de terminación prematuro en la proteína RdxA están asociadas con el fenotipo de resistencia (27). Las mutaciones de los codones de parada encontradas en el presente estudio podrían estar asociadas con dicho fenotipo.

En un estudio reciente en Kuala Lumpur, en el cual se emplearon métodos fenotípicos, se estableció que la resistencia primaria al metronidazol en aislamientos clínicos fue de 32,3 %. Al evaluar las variaciones en el gen rdxA y la correspondiente alteración de la proteína RdxA se encontraron cambios en los aminoácidos en 70,2 % de las cepas resistentes y mutaciones asociadas con codones de parada en 56,8 % (28), lo cual evidencia la importancia de evaluar la resistencia mediante pruebas moleculares (29).

En contraposición a estos hallazgos, en otros estudios se ha reportado la presencia de aislamientos resistentes en los cuales las proteínas RdxA estaban intactas, lo cual sugiere que habría otros genes involucrados en la resistencia al metronidazol, como el gen frxA, el cual participa en su activación en el interior de la célula (20,26). FrxA pueden aumentar los valores de la CIM en los aislamientos resistentes y que las que ocurren en los codones de parada reforzarían el fenotipo resistente (25). Por consiguiente, no hay que desconocer el papel que cumplen otras nitrorreductasas como la frxA, la fdxA y la rpsU en la resistencia al metronidazol (26,27,30).

También, se ha postulado que existen otros mecanismos de resistencia diferentes a las proteínas RdxA o FrxA. Algunas mutaciones en genes relacionados con el potencial de oxidorreducción asociado con el metabolismo del metronidazol y sus productos intermedios activos contra la bacteria, por ejemplo, en la proteína Fur de H. pylori, pueden afectar la sensibilidad al metronidazol al alterar el equilibrio de oxidorreducción mediado por esta proteína, y detener la activación de los productos bactericidas (31).

La combinación de metronidazol con otros antibióticos se utiliza ampliamente en el tratamiento estándar contra la infección por H. pylori y otras infecciones bacterianas anaerobias (32-37). Sin embargo, la resistencia de la bacteria al metronidazol es una de las causas del fracaso del tratamiento de dolencias gástricas (7). En los estudios en los que se emplearon métodos fenotípicos (dilución en agar) en Bogotá, Trespalacios, et al., encontraron una prevalencia de resistencia al metronidazol de 81 % (38); en otro estudio en Pereira, la prevalencia fue de 88 % (29). Estos valores en diferentes poblaciones colombianas indican que la prevalencia de la resistencia a este nitroimidazol supera los límites máximos de 40 % recomendados por el consenso europeo de Maastricht IV (14,39). Según dichas recomendaciones, en áreas geográficas en donde la prevalencia de resistencia sea superior a 40 %, el metronidazol no puede utilizarse en los tratamientos empíricos (39).

A diferencia de los estudios mencionados en Colombia, en otros países latinoamericanos se han reportado datos distintos (8,34): en Chile, se encontró una resistencia al metronidazol de 44,9 %, en una región de México, del 37,1 %, detectada mediante la técnica de E-test (40), y en Brasil se reportaron valores de resistencia de 40,2 % (41). Estas diferencias entre poblaciones indican la importancia de vigilar los niveles de resistencia regional y local, ya que existen diferencias en la prevalencia de la resistencia según las áreas geográficas, lo cual significa que los resultados obtenidos en una región no pueden extrapolarse a otras y, por lo tanto, es fundamental disponer de información específica sobre los niveles de resistencia del microorganismo a los antibióticos usualmente utilizados en los esquemas de erradicación, con el fin de elegir aquellos eficaces y replantear el uso de algunos en el tratamiento empírico (7).

A nivel local no hay publicaciones sobre la resistencia al metronidazol, y aun así, se sigue utilizando frecuentemente en la práctica clínica como tratamiento de primera línea. Lo más preocupante es la ausencia de protocolos para verificar la eficacia de los tratamientos en la erradicación del microorganismo; de hecho, en un estudio en el cual se hizo una encuesta entre médicos generales, especialistas y gastroenterólogos, se encontró que todavía se prescribe el metronidazol como trata miento de primera línea para la infección por H. pylori (42).

En el presente estudio, se determinó por primera vez la frecuencia de las mutaciones en la nitrorre ductasa RdxA en pacientes infectados por H. pylori en el departamento del Cauca. En esta zona del país, se ha reportado una gran prevalencia de H. pylori, y se ha sugerido que los aislamientos circulantes en su población están expuestos a la presión de selección dado el uso indiscriminado de antimicrobianos del tipo de los nitroimidazoles como tratamiento antiparasitario, así como contra infecciones gastrointestinales (42) y, especialmente, en infecciones urinarias y vaginales (8,34). Por ello, debe implementarse la vigilancia de las tasas de erradicación de H. pylori en poblaciones con riesgo de cáncer gástrico. La gran frecuencia de mutaciones (78 %) en la nitrorreductasa RdxA podría estar relacionada con la resistencia al metronidazol.

Se sugiere hacer estudios fenotípicos adicionales para relacionar los resultados de los análisis genéticos obtenidos con las CIM del antibiótico. En los eventuales estudios que se lleven a cabo, debería hacerse el antibiograma de las muestras seleccionadas en pacientes con recurrencia de la infección para establecer la relación con los hallazgos que aquí se presentan. Por ello, se propone emplear el cultivo bacteriano como una herramienta necesaria en pacientes en quienes el tratamiento ha fallado, según lo recomendado por Malfertheiner, et al. (14). Por lo pronto, el análisis de las mutaciones de la proteína RdxA es una excelente aproximación para analizar la resistencia en un gran número de muestras en poblaciones como la de Popayán, en donde los estudios son escasos y, además, no existen las condiciones para cultivar la bacteria. Dada la alta tasa de incidencia de la enfermedad gastrointestinal en Popayán, se deberían proponer programas de prevención de la infección por H. pylori y de promoción del uso adecuado de medicamentos.

En conclusión, este es el primer estudio en el departamento del Cauca en el cual se han evaluado las mutaciones de la nitrorreductasa RdxA, asociadas en diversos estudios con la resistencia de H. pylori al metronidazol en pacientes con dispepsia funcional. Se requieren nuevos estudios para evaluar el impacto de la resistencia en el fracaso del tratamiento en la población de esta región y para establecer la prevalencia de la resistencia a los otros antimicrobianos utilizados para combatir la infección.

Agradecimientos

A los pacientes, por su participación en el estudio, y al personal del Hospital Universitario San José, del Susana López de Valencia y de la Unidad de Endoscopia ENDOVIDEO 2000 de Popayán, por su valiosa asistencia. A la Universidad del Cauca y a la Pontificia Universidad Javeriana de Bogotá, por el apoyo en la ejecución de este proyecto. Al personal de Gastroenterología y Patología, a los colaboradores y auxiliares, y al jefe del Laboratorio de Genética Humana de la Universidad del Cauca.

Conflicto de intereses

Los autores declaran que no tienen ningún tipo de conflicto de intereses.

Financiación

Este estudio fue financiado por el Programa de Salud de Colciencias como parte del proyecto “Mutación en los genes de resistencia antimicrobiana en H. pylori y su relación con la virulencia” (código 110351929123).

Correspondencia:

Claudia P. Acosta, Laboratorio de Genética Humana, Facultad de Ciencias de la Salud, Universidad del Cauca, Calle 5 N° 4-70, Popayán, Colombia

Teléfono y fax: (572) 820 9872
cpacosta@unicauca.edu.co

Referencias

1. Martínez-Júlvez M, Rojas AL, Olekhnovich I, Angarica VE, Hoffman PS, Sancho J. Structure of RdxA–an oxygen‐ insensitive nitroreductase essential for metronidazole activation in Helicobacter pylori. FEBS J. 2012;279:4306-17. http://dx.doi.org/10.1111/febs.12020

2. Gatta L, Vakil N, Vaira D. Treatment of Helicobacter pylori in Latin America. Lancet. 2012;379:407-8. http://dx.doi.org/10.1016/S0140-6736(12)60181-0

3. Graham DY. Helicobacter pylori infection in the pathogenesis of duodenal ulcer and gastric cancer: A model. Gastroenterol. 1997;113:1983-91. http://dx.doi.org/10.1016/S0016-5085(97)70019-2

4. Mendz GL, Mégraud F. Is the molecular basis of metronidazole resistance in microaerophilic organisms understood? Trends Microbiol. 2002;10:370-5. http://dx.doi.org/10.1016/S0966-842X(02)02405-8

5. Gerrits MM, van Vliet AH, Kuipers EJ, Kusters JG.Helicobacter pylori and antimicrobial resistance: Molecular mechanisms and clinical implications. Lancet Infect Dis. 2006;6:699-709. http://dx.doi.org/10.1016/S1473-3099(06)70627-2

6. Kaakoush NO, Asencio C, Mégraud F, Mendz GL. A redox basis for metronidazole resistance in Helicobacter pylori. Antimicrob Agents Chemother. 2009;53:1884-91. http://dx.doi.org/10.1128/AAC.01449-08

7. Camargo MC, García A, Riquelme A, Otero W, Camargo CA, Hernández-García T, et al. The problem of Helicobacter pylori resistance to antibiotics: A systematic review in Latin America. Am J Gastroenterol. 2014;109:485-95. http://dx.doi.org/10.1038/ajg.2014.24

8. Martínez M, David J, Henao R, Consuelo S, Lizarazo R, Iván J. Resistencia antibiótica del Helicobacter pylori en América Latina y el Caribe. Rev Colomb Gastroenterol. 2014;29:218-27.

9. Aldana LP, Kato M, Kondo T, Nakagawa S, Zheng R, Sugiyama T, et al. In vitro induction of resistance to metronidazole, and analysis of mutations in rdxA and frxA genes from Helicobacter pylori isolates. J Infect Chemother. 2005;11:59-63. http://dx.doi.org/10.1007/s10156-004-0370

10. Mirzaei N, Poursina F, Moghim S, Rahimi E,Safaei HG. The mutation of the rdxA gene in metronidazole-resistant Helicobacter pylori clinical isolates. Adv Biomed Res. 2014;3:90. http://dx.doi.org/10.4103/2277-9175.128469

11. Marais A, Bilardi C, Cantet F, Mendz GL, Mégraud F. Characterization of the genes rdxA and frxA involved in metronidazole resistance in Helicobacter pylori. Res Microbiol. 2003;154:137-44. http://dx.doi.org/10.1016/S0923-2508(03)00030-5

12. Jenks P, Ferrero R, Labigne A. The role of the rdxA gene in the evolution of metronidazole resistance in Helicobacter pylori. J Antimicrob Chemother. 1999;43:753-8. http://dx.doi.org/10.1093/jac/43.6.753

13. Goodwin A, Kersulyte D, Sisson G, Veldhuyzen van Zanten SJ, Berg DE, Hoffman PS. Metronidazole resistance in Helicobacter pylori is due to null mutations in a gene (rdxA) that encodes an oxygen-insensitive NADPH nitroreductase. Mol Microbiol. 1998;28:383-93. http://dx.doi.org/10.1046/j.1365-2958.1998.00806.x

14. Malfertheiner P, Megraud F, O’Morain CA, Atherton J, Axon AT, Bazzoli F, et al. Management of Helicobacter pylori infection--the Maastricht IV/Florence consensus report. Gut. 2012;61:646-64. http://dx.doi.org/10.1136/gutjnl-2012-302084

15. Didelot X, Bowden R, Wilson DJ, Peto TE, Crook DW. Transforming clinical microbiology with bacterial genome sequencing. Nature Rev Genet. 2012;13:601-12. http://dx.doi.org/10.1038/nrg3226

16. Stolte M, Meining A. The updated Sydney system: Classification and grading of gastritis as the basis of diagnosis and treatment. Can J Gastroenterol. 2001;15:591-8. http://dx.doi.org/10.1155/2001/367832

17. Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis: The updated Sydney system. Am J Surg Pathol. 1996;20:1161-81. http://dx.doi.org/10.1097/00000478-199610000-00001

18. Acosta CP, Hurtado FA, Trespalacios AA. Determinación de mutaciones de un solo nucleótido en el gen 23S rRNA de Helicobacter pylori relacionadas con resistencia a claritromicina en una población del departamento del Cauca, Colombia. Biomédica. 2014;34:156-62. http://dx.doi.org/10.7705/biomedica.v34i0.1649

19. NCBI. Helicobacter pylori strain 26695-1MET, complete genome. Fecha de consulta: 26 de marzo de 2015. Disponible en: http://www.ncbi.nlm.nih.gov/nuccore/CP010436.1

20. Kwon D, Hulten K, Kato M, Kim J, Lee M, El-ZaatariF, et al. DNA sequence analysis of rdxA and frxA from 12 pairs of metronidazole-sensitive and-resistant clinical Helicobacter pylori isolates. Antimicrob Agents Chemother. 2001;45:2609-15. http://dx.doi.org/10.1128/AAC.45.9.2609-2615.2001

21. NCBI BLAST. NCBI BLAST: Basic Local Alignment Search Tool. Bethesda: National Library of Medicine. Fecha de consulta: 28 de junio de 2015. Disponible en: https://blast.ncbi.nlm.nih.gov/Blast.cgi

22. Bereswill S, Krainick C, Stähler F, Herrmann L, Kist M. Analysis of the rdxA gene in high-level metronidazole- resistant clinical isolates confirms a limited use of rdxA mutations as a marker for prediction of metronidazole resistance in Helicobacter pylori. FEMS Immunol Med Microbiol. 2003;36:193-8. http://dx.doi.org/10.1016/S0928-8244(03)00031-2

23. Tomb J-F, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, et al. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature. 1997;388:539-47. http://dx.doi.org/10.1038/41483

24. EMBL-EBI. CLUSTALW2. Fecha de consulta: 3 de agosto de 2015. Disponible en: http://www.ebi.ac.uk/Tools/msa/clustalw2/

25. Kwon DH, Kato M, El-Zaatari FA, Osato MS, Graham DY. Frame-shift mutations in NAD (P) H flavin oxidoreductase encoding gene (frxA) from metronidazole resistant Helicobacter pylori ATCC43504 and its involvement in metronidazole resistance. FEMS Microbiol Lett. 2000;188:197-202. http://dx.doi.org/10.1111/j.1574-6968.2000.tb09193.x

26. Jeong J-Y, Mukhopadhyay AK, Dailidiene D, Wang Y, Velapatiño B, Gilman RH, et al. Sequential inactivation of rdxA (HP0954) and frxA (HP0642) nitroreductase genes causes moderate and high-level metronidazole resistance in Helicobacter pylori. J Bacteriol. 2000;182:5082-90. http://dx.doi.org/10.1128/JB.182.18.5082-5090.2000

27. Solcà NM, Bernasconi MV, Piffaretti J-C. Mechanism of metronidazole resistance in Helicobacter pylori: Comparison of the rdxA gene sequences in 30 strains. Antimicrob Agents Chemother. 2000;44:2207-10. http://dx.doi.org/10.1046/j.1469-0691.2000.00015.x

28. Teh X, Khosravi Y, Lee WC, Leow AH, Loke MF, Vadivelu J, et al. Functional and molecular surveillance of Helicobacter pylori antibiotic resistance in Kuala Lumpur. PLoS One. 2014;9: e101481. http://dx.doi.org/10.1371/journal.pone.0101481

29. álvarez A, Moncayo JI, Santacruz JJ, Santacoloma M, Corredor LF, Reinosa E. Antimicrobial susceptibility and mutations involved in clarithromycin resistance in Helicobacter pylori isolates from patients in the western central region of Colombia. Antimicrob Agents Chemother. 2009;53:4022-4. http://dx.doi.org/10.1128/AAC.00145-09

30. Binh TT, Suzuki R, Trang TTH, Kwon DH, Yamaoka Y. Search for novel candidate mutations for metronidazole resistance in Helicobacter pylori using next-generation sequencing. Antimicrob Agents Chemother. 2015;59:2343-8. http://dx.doi.org/10.1128/AAC.04852-14

31. Wu W, Yang Y, Sun G. Recent insights into antibiotic resistance in Helicobacter pylori eradication. Gastroenterol Res Pract. 2012;2012:723183. http://dx.doi.org/10.1155/2012/723183

32. Rimbara E, Fischbach LA, Graham DY. Optimal therapy for Helicobacter pylori infections. Nat Rev Gastroenterol Hepatol. 2011;8:79-88. http://dx.doi.org/10.1038/nrgastro.2010.210

33. Heo J, Jeon SW. Optimal treatment strategy for Helicobacter pylori: Era of antibiotic resistance. World J Gastroenterol. 2014;20:5654-9. http://dx.doi.org/10.3748/wjg.v20.i19.5654

34. Greenberg ER, Anderson GL, Morgan DR, Torres J, Chey WD, Bravo LE, et al. 14-day triple, 5-day concomitant, and 10-day sequential therapies for Helicobacter pylori infection in seven Latin American sites: A randomised trial. Lancet. 2011;378:507-14. http://dx.doi.org/10.1016/S0140-6736(11)60825-8

35. Malfertheiner P, Megraud F, O’Morain C, Bazzoli F, El-Omar E, Graham D, et al. Current concepts in the management of Helicobacter pylori infection: The Maastricht III Consensus Report. Gut. 2007;56:772-81. http://dx.doi.org/10.1136/gut.2006.101634

36. Megraud F, Lamouliatte H. Review article: The treatment of refractory Helicobacter pylori infection. Aliment Pharmacol Ther. 2003;17:1333-43. http://dx.doi.org/10.1046/j.1365-2036.2003.01592.x

37. Graham DY, Fischbach L. Helicobacter pylori treatment in the era of increasing antibiotic resistance. Gut. 2010;59:1143-53. http://dx.doi.org/10.1136/gut.2009.192757

38. Trespalacios A, Otero W, Mercado M. Resistencia de Helicobacter pylori a metronidazol, claritromicina y amoxi-cilina en pacientes colombianos. Rev Colomb Gastroenterol. 2010;25:31-8.

39. Almeida N, Donato MM, Romãozinho JM, Luxo C, Cardoso O, Cipriano MA, et al. Beyond Maastricht IV: Are standard empiric triple therapies for Helicobacter pylori still useful in a South-European country? BMC Gastroenterol. 2015;15:23. http://dx.doi.org/10.1186/s12876-015-0245-y

40. Garza-González E, Pérez-Pérez G, Alanis-Aguilar O, Tijerina-Menchaca R, Maldonado-Garza H, Bosques- Padilla F. Antibiotic susceptibility patterns of Helicobacter pylori strains isolated from northeastern México. J Chemother. 2002;14:342-5. http://dx.doi.org/10.1179/joc.2002.14.4.342

41. Ogata SK, Gales AC, Kawakami E. Antimicrobial susceptibility testing for Helicobacter pylori isolates from Brazilian children and adolescents: Comparing agar dilution, E-test, and disk diffusion. Braz J Microbiol. 2014;45:1439-48. http://dx.doi.org/10.1590/S1517-83822014000400039

42. Gómez M, Otero W, Gutiérrez ó. Tratamiento de la infección por Helicobacter pylori. Encuesta en un grupo de médicos generales y especialistas en Colombia. Rev Colomb Gastroenterol. 2007;22:7-16.

Métricas de artículo

Cargando métricas ...

Metrics powered by PLOS ALM




Revista Biomédica -  https://doi.org/10.7705/issn.0120-4157
ISSN 0120-4157

Instituto Nacional de Salud
INSTITUTO NACIONAL DE SALUD
Avenida Calle 26 No. 51-20
Apartado aéreo 80334 y 80080
Bogotá, D.C., Colombia, S.A.
Teléfono: 05712207700 Ext. 1386
Correo electrónico: biomedica@ins.gov.co