Biomédica 2017;37:378-89

doi: https://doi.org/10.7705/biomedica.v34i2.3239

ARTÍCULO ORIGINAL

Efecto mutagénico y genotóxico, y expresión de los genes Rad51C, Xiap, P53 y Nrf2 inducidos por extractos antipalúdicos de plantas recolectadas en el Vaupés medio, Colombia

Claudia Viviana Barbosa1,2, Carlos Enrique Muskus3, Luz Yaneth Orozco4, Adriana Pabón1

1Grupo de Malaria, Facultad de Medicina, Universidad de Antioquia, Medellín, Colombia

2 Facultad de Ciencias de la Salud, Fundación Universitaria María Cano, Medellín, Colombia

3 Unidad de Biología Molecular y Computacional, Programa de Estudio y Control de Enfermedades Tropicales, PECET, Facultad de Medicina, Universidad de Antioquia, Medellín, Colombia

4 Grupo de Gestión y Modelación Ambiental, GAIA, Facultad de Ingeniería, Universidad de Antioquia, Medellín, Colombia

Contribución de los autores:

Claudia Viviana Barbosa: diseño de la investigación, pruebas experimentales, tabulación de los datos y análisis de los resultados

Carlos Enrique Muskus: asesoría en las pruebas de expresión génica y análisis de los resultados

Luz Yaneth Orozco: asesoría en el análisis de los resultados de los efectos mutagénico y genotóxicos

Adriana Pabón: asesoría en las pruebas de actividad antiplasmódica y análisis de los resultados

Todos los autores participaron en la redacción del artículo.


Introducción: Dada la resistencia de Plasmodium a los medicamentos antipalúdicos, es necesario encontrar nuevas alternativas terapéuticas para su tratamiento y control. Con base en el saber indígena colombiano, se recopilaron extractos de plantas del Vaupés medio con potencial efecto antipalúdico.

Objetivo: Evaluar el efecto mutagénico y genotóxico, y la expresión de los genes Rad51C, Xiap, P53 y Nrf2, inducidos por cuatro extractos etanólicos con actividad anti-Plasmodium (R001, T002, T015 y T028).

Materiales y métodos: Se evaluó el potencial mutagénico de cuatro extractos etanólicos con efecto antiplasmódico utilizando el test de Ames y el efecto genotóxico, con un ensayo del cometa; asimismo, se analizó la expresión de los genes Rad51C, Xiap, P53 y Nrf2 en células HepG2.

Resultados: Los extractos no fueron mutágenos en la cepa TA98 de Salmonella typhimurium en presencia y ausencia de actividad metabólica de la fracción S9. En la cepa TA100, los extractos R001, T015 y T028 se comportaron como mutágenos débiles en presencia de S9, con índices mutagénicos de 1,58; 1,38; 1,53 y 1,61, respectivamente; T015 tuvo el mismo comportamiento en ausencia de S9, con un índice mutagénico de 1,36. En el ensayo del cometa, todos los extractos provocaron daño de categorías 1 o 2, con colas de cometas entre 36,7 y 51,48 μm de longitud; sin embargo, el índice de daño genético sugirió que los tratamientos afectaron la mayoría de las células. En los genes en estudio, los extractos R001 y T028 indujeron una sobreexpresión de 1,84 a 3,99 frente a las células sin tratar de los genes Xiap y P53.

Conclusiones: Los resultados evidenciaron que el extracto T002 fue el más seguro, ya que presentó actividad anti-Plasmodium, no fue citotóxico en las células HepG2, no fue mutágeno, causó daño de categoría 1 en el ADN y no modificó la expresión de los genes evaluados.

Palabras clave: malaria; resistencia a medicamentos; mutación; daño del ADN; apoptosis; estrés oxidativo.

doi: https://doi.org/10.7705/biomedica.v34i2.3239


Mutagenicity, genotoxicity and gene expression of Rad51C, Xiap, P53 and Nrf2 induced by antimalarial extracts of plants collected from the middle Vaupés region, Colombia

Introduction: Due to Plasmodium resistance to antimalarial drugs, it is important to find new therapeutic alternatives for malaria treatment and control. Based on the knowledge of Colombian indigenous communities, we collected extracts of plants with potential antimalarial effects from the middle Vaupés region.

Objective: To evaluate the mutagenic and genotoxic effects, as well as the gene expression of Rad51C, Xiap, P53 and Nrf2 induced by four ethanolic extracts with antimalarial activity (R001, T002, T015 and T028).

Materials and methods: We evaluated four ethanolic extracts with antimalarial activity using the Ames test to assess mutagenicity, and the comet assay on HepG2 cells to determine the genotoxicicity. We also evaluated the expression of Rad51C, Xiap, P53 and Nrf2 from HepG2 cells stimulated with the four extracts.

Results: None of the four extracts was mutagenic in Salmonella typhimurium TA98 strain in the presence and absence of S9 metabolic activity. Extracts R001, T015 and T028 were weakly mutagenic on the TA100 strain in the presence of S9, with mutagenic indexes (MI) of 1.58, 1.53 and 1.61, respectively. The T015 strain showed the same behavior without S9 with an MI of 1.36. The results of the comet assay showed that the four extracts produced category 1 or 2 damage, with comets between 36.7 and 51.48 μm in length. However, the genetic damage index suggested that most of the cells were affected by the treatments. Regarding gene expression, extracts R001 and T028 induced an overexpression of genes Xiap and P53 with an 1.84 to 3.99 fold-change compared with untreated cells.

Conclusions: These results revealed that the T002 extract was the safest as it had antimalarial activity and was not cytotoxic on HepG2 cells. Moreover, it was not mutagenic and it only produced category 1 damage on the DNA. Also, the extract did not induce a change in the expression of the tested genes.

Key words: Malaria; drug resistance; mutation; DNA damage; apoptosis; oxidative stress.

doi: https://doi.org/10.7705/biomedica.v34i2.3239


La malaria, o paludismo, es la enfermedad parasitaria transmitida por vectores de mayor prevalencia e impacto en la salud pública a nivel mundial, con cerca de 200 millones de casos anualmente (1). Existe la necesidad de encontrar nuevas alternativas terapéuticas para el tratamiento de la malaria dada la resistencia progresiva del parásito a medicamentos como los derivados de las aminoquinolinas (cloroquina, amodiaquina) o de las artemisininas (2).

Una alternativa para desarrollar nuevos medicamentos antipalúdicos son las plantas, ya que constituyen una importante fuente de recursos terapéuticos que se utilizan para el tratamiento de diversas enfermedades infecciosas en muchos países en desarrollo (3,4) y se calcula que 80 % de las personas en el mundo utilizan remedios naturales para el tratamiento de sus dolencias (3). Además, muchos de los medicamentos utilizados en el mundo son moléculas derivadas de las plantas mediante semisíntesis; entre ellos, se encuentran los derivados de la artemisinina, como el artesunato, el artemeter y el arteheter, obtenidos de la planta Artemisia annua, así como la quinina de diferentes especies del género Chinchona, los cuales se utilizan como antipalúdicos (5,6).

En esta búsqueda de nuevas moléculas para el tratamiento de enfermedades, la etnobotánica ha permitido estudiar cómo las comunidades de una región en particular utilizan las plantas autóctonas como alimento, como medicina y para otros usos (3). Las comunidades indígenas de Colombia no son ajenas a estas prácticas; tal es el caso de aquellas asentadas en el departamento del Vaupés (3).

En este sentido, antes de este estudio, en el Grupo de Malaria de la Universidad de Antioquia se evaluó la actividad antiplasmódica y citotóxica in vitro de los extractos acuosos y etánolicos preparados a partir de 35 plantas consideradas antipalúdicas por los médicos tradicionales de la región del Vaupés medio, y se encontró que 5 % de 72 extractos etanólicos presentó una significativa actividad anti-Plasmodium (<5 μg/ml) y 83 % de ellos no fueron tóxicos (7). Estos resultados demuestran la importancia del uso tradicional que las comunidades ancestrales de la Amazonia dan a las plantas, lo cual contribuiría a solucionar un problema de salud pública como la malaria en todo el mundo.

Sin embargo, la obtención de un medicamento para el tratamiento de la malaria a partir de plantas del departamento del Vaupés requiere una serie de estudios que garanticen su eficacia y su seguridad, mediante pruebas farmacológicas y toxicológicas in vitro e in vivo (8,9). En ese contexto, se evaluó el potencial mutagénico en cepas de Salmonella typhymurium (test de Ames), el genotóxico (ensayo cometa) y la expresión de los genes Rad51C, Xiap, P53 y Nrf2 en células HepG2 tratadas con cuatro extractos etánolicos preparados a partir de las plantas reportadas como antipalúdicos por los médicos tradicionales de la región del Vaupés y que presentaron una actividad antiplasmódica promisoria in vitro.

Materiales y métodos

Obtención y selección de los extractos etanólicos

A partir del estudio de Pabón, et al. (7), se seleccionaron los extractos etanólicos R001, T002, T015 y T028 de las hojas, los tallos, las raíces y las cortezas de plantas pertenecientes a los géneros Citrus sp., Matisia sp., Psidium sp. y Rudgea sp. Estos extractos presentaron una actividad antiplasmódica prometedora in vitro, con una concentración inhibitoria (CI50) de 1,65 a 10,62 μg/ml, una concentración citotóxica 50 (CI50) de 65 a 10,62 μg/ml y un índice de selectividad de más de 2, lo cual indica que son selectivos para el parásito, según lo reportan varios autores (7,10,11) (cuadro 1).

Cultivos celulares

En el test de Ames se utilizaron bacterias de S. typhimurium, específicamente las cepas TA 98 y TA 100, en las cuales se produce la reversión de His- a His+ por pérdida o ganancia de bases y por sustitución de un par de bases, respectivamente. Se cultivaron en caldo nutritivo durante 16 a 18 horas, hasta obtener una concentración de 2 x 109 bacterias/ml para hacer la prueba (8).

En el ensayo cometa y en los ensayos de expresión génica, se utilizó la línea celular HepG2 mantenida en el Grupo de Malaria de la Universidad de Antioquia. Estas células se cultivaron en medio DMEM-F12 con suplemento de 10 % de suero fetal bovino (Invitrogen) y 1 % de penicilina y estreptomicina (10.000 U/ml, Invitrogen) y se mantuvieron en atmósfera húmeda con 5 % de CO2 a 37 °C (7).

Test de Ames

El efecto mutagénico de los cuatro extractos etanólicos seleccionados, se evaluó con el test de Ames en las cepas de Salmonella typhimurium TA98 y TA100, usando el protocolo descrito por Maron y Ames, y modificado por Flückiger-Isler en el 2006 (8,12). Los ensayos se hicieron con enzimas microsómicas (S9) de Moltox y sin estas.

Se utilizaron como controles negativos el DMSO en una concentración final de 2,38 % y agua destilada. Como controles positivos directos (sin S9), se usaron óxido de 4-nitroquinolina (4NQO) para la cepa TA 98 y azida de sodio para la cepa TA 100, ambos en una concentración de 5 μg/ml, y como control positivo indirecto (con S9), 10 μg/m de 2 aminofluoreno (2AF) para ambas cepas.

Se evaluaron dosis de 25, 22, 85, 3, 1,5 y 18, 12 μg/ml de los extractos R001, T002, T015 y T028, respectivamente, las cuales no fueron tóxicas en las cepas de S. typhimurium. Para clasificar los extractos como mutágenos, se tuvo en cuenta el respectivo índice mutagénico, el cual indica las veces que la cantidad de colonias revertantes presentes en el control negativo es superada. Para calcularlo, se tuvieron en cuenta los criterios de Flückiger-Isler establecidos en el 2012 (13), según los cuales los ensayos en los que se obtenga un índice mutagénico de 1,5 a 2,5 en el control indican que la sustancia probada tiene poco efecto mutagénico positivo y que el de las sustancias con resultados superiores a 3 es elevado.

Ensayo cometa

Para garantizar que los resultados observados fueran por causa de efectos genotóxicos y no de procesos citotóxicos que también involucran rupturas del ADN, fue necesario asegurar que la viabilidad de las células HepG2 fuera superior a 70 ± 5 % después del tratamiento, para evitar, así, los falsos positivos (14). Por esta razón, se determinó la viabilidad de cada muestra mediante exclusión con azul de tripano.

Se siguió el protocolo publicado por Singh, et al., en 1988 (15) con las modificaciones de Flückiger, et al. en el 2006 (8,16).

En esta prueba se hicieron dos experimentos independientes por duplicado utilizando solución tampón PBS (Phosphate Buffered Saline) como control negativo, 100 mM de peróxido de hidrógeno (H2 O2

) como control positivo (16) y DMSO (dimetilsulfóxido) al 1 % como control de solvente.

Para las lecturas, las placas se colorearon con bromuro de etidio en una concentración de 2 μl/ml y se utilizó un microscopio de fluorescencia marca Boeco con filtro verde y amplificación de 20X.

Se analizaron 50 células seleccionadas al azar por lámina, para un total de 100 células por experimento y 200 por muestra. Los resultados se expresaron como longitud de cola del cometa en micrómetros (μm) y el resultado de cada electroforesis se consideró solo si los controles positivos mostraban resultados positivos.

Para conocer la magnitud del daño genético causado por cada extracto, se reportó el porcentaje de células afectadas, incluidas todas las células con valores bajos, moderados, elevados y extremos de daño en el ADN (clasificación 0 a 4) en el ensayo cometa. Los resultados de los ensayos cometa se clasificaron empleando una escala arbitraria de cinco categorías según el porcentaje de ADN en la cola: 0, cuando no había daño (<5 %); 1, cuando este era bajo (5-20 %); 2, cuando era moderado (20- 40 %); 3, elevado (40-80 %), o 4, extremo (>80 %) (17). Los cometas sin cabeza, también llamados “nubes”, no se incluyeron en el análisis.

El daño en el ADN se cuantificó mediante la clasificación visual de nucleoides en cinco clases de cometas según la intensidad y la longitud de la cola de 0 (sin la cola) a 4 (casi todo el ADN en la cola) (17,18). La puntuación total, expresada como índice de daño genético (IDG), se calculó multiplicando el porcentaje medio de nucleoides en cada clase por el factor correspondiente, con la siguiente fórmula:

IDG = [(n0 * 0) + (n1 * 1) + (n2 * 2) + (n3 * 3) + (n4 *

4)] / total de células, donde n0 corresponde al número de células con un nivel de daño 0; n1, al número con un nivel de daño 1; n2 , al número con un nivel de daño 2; n3 , al número con un nivel de daño 3, y n4, al número de células con un nivel de daño 4.

Los resultados se expresaron como unidades arbitrarias en una escala de 0 a 400 por 100 nucleoides anotados, según lo descrito por Guilherme, et al., en el 2010 (17).

Extracción de ARN y reacción en cadena cuantitativa de la polimerasa, q-PCR

Antes de la extracción de ARN, las células HepG2 se trataron durante 24 horas con los cuatro extractos etanólicos, y como controles positivos se emplearon las sustancias genotóxicas óxido de 4-notroquinolina (4NQO), benzo(a)pireno (B(a)P), y etopósido, y el inductor de estrés oxidativo terbutil hidroperóxido (t-BuOOH) (9,19-24).

Se utilizaron las concentraciones anti-Plasmodium IC50 de los extractos, las cuales no presentaron efecto citotóxico. El ARN total (ARNt) de las células tratadas se obtuvo por el método de trizol, según el protocolo del proveedor (Sigma-Aldrich, Invitrogen, Burlington, ON, Canadá) (25,26), y su concentración se determinó con NanoDrop® en el rango de 162,8 a 266,0 ng/μl; su calidad se evaluó mediante electroforesis en gel de agarosa al 1,5 y a 100 voltios durante 45 minutos. Posteriormente, se hizo la transcripción inversa utilizando el estuche QuantiTect Reverse Transcription® de Qiagen.

Para el desarrollo de la reacción en cadena cuantitativa de la polimerasa (q-PCR), se diseñaron iniciadores específicos de los genes Rad51C (forward GATGTGCAGATACCAGAATG y reverse CTATAAGCTGAAGGTGCTGA), Xiap (forward GTG TACCTGCAGACATCAAT y reverse TGATGCTGA AACAGGACTAC), P53 (forward CCTATGGAAACT ACTTCCTG y reverse GAGCTTCATCTGGACCTG), Nrf2 (forward CCAGCAGGACATGGATTT y reverse ATACTCTTTCCGTCGCTGACT) y para el gen normalizador GADPH (forward GGTGTGAACCATG AGAAGTA y reverse CCACGATACCAAAGTTGTC) utilizando el programa Primer3plus (http://www. bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/).

La tendencia a formar bucles, homodímeros y heterodímeros se determinó con el programa Oligo Analyzer (https://www.idtdna.com/calc/analyzer). La especificidad del reconocimiento de los iniciadores de la secuencia blanco se verificó mediante BLAST (Basic Local Alignment Search Tool) (http://www.ncbi.nlm.nih.gov/BLAST/).

La reacción de amplificación se hizo con el estuche Quantifast SYBR Green PCR® siguiendo las instrucciones del fabricante.

Las siguientes fueron las condiciones que se tuvieron en cuenta en la q-PCR: 95 °C durante cinco minutos para permitir la activación de la polimerasa, seguidos de 35 ciclos a 95 °C durante 10 segundos para la desnaturalización del ADN, a 56 °C durante 50 segundos para el alineamiento de los cebadores a las cadenas de ADN y a 72 °C durante 15 segundos para la extensión final de las cadenas. Para determinar la expresión del gen en estudio, se hizo una cuantificación relativa con el método 2–(∆∆ct), el cual es un modelo matemático que calcula el número de veces que se amplifica una muestra experimental con respecto a una muestra de control (no tratada) (27).

Análisis estadístico

En las pruebas del efecto mutagénico y genotóxico utilizadas para hacer las comparaciones múltiples, se hizo un análisis de varianza (ANOVA o Kruskal- Wallis para datos no paramétricos) con el paquete estadístico SPSS®, versión 19, mediante una prueba de homogeneidad post hoc con un alfa de 0,05.

En el caso del efecto mutagénico, se compararon los promedios de colonias revertantes de los tratamientos comparados con el control negativo (DMSO) y la activación metabólica.

En cuanto al efecto genotóxico, se comparó el promedio de la longitud de cola de los cometas en los diferentes tratamientos con el control negativo DMSO al 1 %.

En cuanto a la expresión de los genes Rad51C, Xiap, P53 y Nrf2, después de la cuantificación relativa con el método 2–(ΔΔct), se compararon las medias con una significación menor de 0,05, utilizando el programa estadístico SPSS®.

Resultados

La actividad anti-Plasmodium de los extractos R001, T002, T015 y T028 fluctuó entre 1,65 y 10,62 μg/ml. En cuanto al efecto citotóxico, su rango fluctuó entre 36,94 y 148,05 μg/ml. El extracto T028 demostró la mayor actividad (1,65 ± 0,61 μg/ml) y un efecto citotóxico de 37,62 ± 1,97 μg/ml. Los extractos T002 y T015 no se consideraron citotóxicos, con concentraciones (CC50) de 148,05 ± 7,42 y 102,90 ± 10,89 μg/ml, respectivamente (cuadro 1).

Efecto mutagénico de los extractos etanólicos con actividad anti-Plasmodium en cepas de Salmonella typhimurium

Los extractos evaluados presentaron un índice mutagénico menor de 1,5 en la cepa TA98 con la fracción S9 y sin ella, es decir, no fueron mutágenos. Estos resultados se confirmaron mediante el análisis de varianza (p>0,05) y la prueba post hoc (p>0,05), en las cuales no se encontró diferencia estadísticamente significativa entre el número de colonias revertantes obtenido en el control negativo (DMSO) y los tratamientos (cuadro 2, figura 1A).

Sin embargo, en la cepa TA100 se encontró que los extractos R001, T015 y T028 en presencia de S9 presentaron un índice mutagénico mayor de 1,5, lo cual indica que en estas condiciones se comportaron como mutágenos indirectos débiles (p<0,05 con respecto al control negativo).

El extracto T015 presentó diferencias estadísticamente significativas con respecto al control negativo en ausencia de S9, con un índice mutagénico de 1,36 y un valor de p de 0,005, lo cual indicaba la presencia de metabolitos que actuaban como mutágenos directos (cuadro 2, figura 1B).

El extracto T002 presentó un índice mutagénico menor de 1,5, es decir, no registró efecto mutagénico (cuadro 2, figura 1A y B).

Efecto genotóxico de los extractos etanólicos con actividad anti-Plasmodium en la línea celular HepG2

La comparación de los resultados sobre el efecto genotóxico de los extractos y el del control negativo DMSO, se catalogaron como genotóxicos (prueba de Tukey con un valor de p<0,05), así: R001 produjo daño de tipo 2, y T002, T015 y T028, de tipo 1, pues presentaban, en promedio, de 20 a 40 % y de 5 a 20% de ADN en las colas de los cometas.

Los índices de daño genético de los cuatro extractos estuvieron muy por encima del control negativo, en un rango de 299 a 399. El porcentaje de células dañadas después de una hora de exposición a los extractos fue mayor de 75 % (de 80 núcleos contados, 60 presentaron fragmentación del ADN) y de 0 % en el control negativo.

Es importante anotar que la viabilidad después del tratamiento, medida con el método de exclusión de azul de tripano, fue mayor de 95 % en todos los tratamientos, con lo cual se garantizó que no se probaran dosis letales (cuadro 3 y figura 2).

Expresion de los genes Rad51C, Xiap, P53 y Nrf2 eón la línea celular HepG2 expuesta a compuestos mutagénicos, genotóxicos y a extractos etanólicos con actividad anti-Plasmodium

En los ensayos de expresión génica en la línea celular HepG2, el control endógeno GADPH no se afectó con el tratamiento de las células expuestas a los compuestos químicos empleados como controles de los efectos mutagénico y genotóxico (4NQO, B(a) P, etopósido, t-BuOOH), ni a los extractos etanólicos (R001, T002, T015 y T028). Además, la eficiencia de amplificación fue similar a la de los genes Rad51C, Xiap, P53 y Nrf2, en los cuales estuvo en un rango de 92 a 99 %.

La sobreexpresión fue estadísticamente significativa en el gen Rad51C cuando las células se trataron con t-BuOOH, con una diferencia de expresión de 12,83 veces. En el gen Xiap, se observó sobreexpresión de 9,66, 23,79, 2,99 y 3,11 con los tratamientos B(a) P, t-BuOOH, R001 y T028, respectivamente. En el caso del gen P53, la sobreexpresión fue de 4,48, 1,84 y 3,91 veces con los tratamientos t-BuOOH, R001 y T028, respectivamente. Por último, el gen Nrf2 solo se sobreexpresó 10,89 veces con t-BuOOH. Estos valores de sobreexpresión se compararon con la expresión de los genes analizados en células sin tratamiento, partiendo de una expresión basal de 1 (p<0,05) (figura 3).

Discusión

Los datos de actividad anti-Plasmodium y del efecto citotóxico de los extractos R001, T002, T015 y T028 preparados a partir de las plantas utilizadas por los indígenas de la región del Vaupés medio para tratar la malaria, evidenciaron su selectividad por P. falciparum y no por las células del huésped.

Estos resultados sugieren la presencia de metabolitos que podrían jugar un papel importante en la interacción con los parásitos y el medio ambiente (28). Sin embargo, se requieren otras pruebas para evaluar su efecto citotóxico in vitro, como las de hemólisis o de reducción de rezasurina, entre otras (29), con el fin de conocer si los extractos alteran otras vías metabólicas y, de esta manera, poder sugerirlos como materia prima en la elaboración de una fórmula farmacéutica segura y efectiva contra la malaria.

En la evaluación del efecto mutagénico de los extractos en estudio, se encontró que no causaron mutaciones por pérdida o ganancia de bases detectadas en la cepa TA98 con la fracción S9 y sin ella. En el estudio de García, et al., se registraron resultados similares en el 2013, con extractos estandarizados de Solanium nudum con actividad anti-Plasmodium promisoria (10).

Cuando se evaluó el efecto mutagénico en la cepa TA100 con S9, los extractos R001, T015 y T028 se comportaron como mutágenos débiles al presentar un índice mutagénico entre 1, 5 y 2,5, lo cual indica que causan mutaciones por sustitución de pares de bases y que se trata de promutágenos que requieren ser metabolizados por las enzimas de fase I antes de interactuar con la molécula de ADN y producir la mutación (30).

En la misma cepa, pero sin S9, se obtuvo un resultado positivo débil con el extracto T015. Los resultados de este tratamiento con la fracción S9 y sin ella indican que T015 puede contener moléculas que se comportan como mutágenos directos e indirectos.

Es importante resaltar que el test de Ames se utiliza ampliamente y es una de las pruebas recomendadas por la Environmental Protection Agency (EPA) de los Estados Unidos para evaluar el riesgo mutagénico de contaminantes ambientales y sustancias para consumo humano, entre otros (31-33). Sin embargo, se debe tener en cuenta que se trata de un modelo bacteriano, por lo cual no es posible extrapolar estos resultados a células u organismos eucariotas.

En cuanto al efecto genotóxico de los extractos seleccionados en la línea celular HepG2, se encontraron diferencias estadísticamente significativas al comparar los resultados con los del control negativo (DMSO al 0,5%). Con base en las categorías de daño establecidas por Guilherme, et al. (17), los extractos se clasificaron así: R001 produjo daño de tipo 2, y T002, T015 y T028, de tipo 1, es decir, pueden causar rupturas en el ADN de cadena sencilla y doble (32). Sin embargo, es importante resaltar que los índices de daño genético superaron el control negativo entre nueve y 12 veces, lo cual significa que la mayoría de las células se vio afectada por los tratamientos, aunque el daño fuera mínimo (32,34).

Los resultados del efecto genotóxico se correlacionaron con los resultados de la evaluación del efecto mutagénico, ya que la mutación se fija después de que ocurre el daño en el ADN (33). No obstante, se debe tener en cuenta que los sistemas utilizados en ambas pruebas fueron diferentes, ya que el efecto mutagénico se evaluó en células procariotas y, el genotóxico, en eucariotas.

El ensayo cometa es otra de las pruebas recomendadas por la EPA para evaluar la seguridad toxicológica de diversos compuestos de uso humano (31). Esta técnica se ha utilizado en la evaluación genotóxica de extractos con actividad biológica frente a microorganismos como P. falciparum y Mycobacterium tuberculosis, entre otros (33).

En este estudio también se evaluó el comportamieto de los extractos con actividad anti-Plasmodium en algunos procesos celulares, como la recombinación homóloga, la inhibición de la apoptosis, la regulación del ciclo celular y la desintoxicación enzimática, para lo cual se escogieron los siguientes genes:

1) el gen Rad51C, perteneciente a la familia de genes Rad51 (9) y considerado óptimo para evaluar el efecto genotóxico, pues está presente en los seres humanos y varias de las proteínas codificadas por esta familia tienen un papel crucial en los procesos de reparación del ADN por recombinación homóloga (34);

2) el gen Xiap, el cual hace parte de la familia de genes que codifican las proteínas inhibidoras de la apoptosis (AIP) (35,36); la proteína codificada por este gen ha sido la mejor caracterizada en cuanto a su función inhibidora de las caspasas 3, 7 y 9 (35,36);

3) el gen supresor de tumores P53, que codifica una proteína fundamental en la reacción al daño en el ADN producido por agentes físicos, como la radiación, o químicos, como la exposición a fármacos, por ejemplo el etopósido, y que también protege la célula de daños producidos por la activación de oncogenes (9,37), y

4) el gen Nrf2, el cual codifica para una proteína que participa en la desintoxicación celular activando enzimas de fase II (38,39), y actúa como factor de transcripción de proteínas encargadas del equilibrio redox de oxidorreducción (40).

En este contexto, en las pruebas de q-PCR con el ARNm de las células HepG2, se obtuvieron resultados estadísticamente significativos en la expresión de los genes en estudio expuestos a diferentes tratamientos. Estos resultados se discutieron a la luz del estudio de Westerink, et al. (9), quienes desarrollaron un sistema de genes reporteros de luciferasa en células HepG2 utilizando las regiones promotoras de los genes Rad51C, CST3, P5 y Nrf2, con el cual se probaron 22 compuestos mutagénicos y genotóxicos, algunos de los cuales fueron utilizados en el presente trabajo.

En el estudio de Westerink, et al., se consideró que había una reacción genotóxica positiva si los tratamientos superaban en 1,5 veces la luminiscencia del control negativo. Bajo este criterio, el t-BUOOH utilizado en este estudio en una concentración de 0,5 μM, provocó la sobreexpresión de los genes Rad51C, Xiap, P53 y Nrf2 con una diferencia de expresión frente al control de 12,83, 23,79, 4,48 y 10,98, respectivamente, lo cual podría deberse a que este compuesto es un potente agente oxidante que induce estrés oxidativo en diferentes órganos de animales, y ello provoca un aumento significativo en la producción de especies reactivas del oxígeno que causan daño oxidativo en las macromoléculas intracelulares (41).

Esto respalda los resultados del presente estudio, ya que al aumentar los niveles intracelulares de las especies reactivas del oxígeno, estos podrían inducir la sobreexpesión de Nrf2, el cual juega un papel importante como factor de transcripción de enzimas clave en la desintoxicación celular y en el equilibrio de oxidorreducción; esto ayuda a la célula a contrarrestar los efectos negativos de las especies reactivas del oxígeno (42).

En el estudio de Westerink, et al., se obtuvieron resultados positivos en los ensayos de genes reporteros, con una inducción de luminiscencia en Nrf2 19 veces mayor que en el control al usar otro inductor de las especies reactivas del oxígeno como el H2 O2 en una concentración de 1 μM (9). Por otro lado, la sobreexpresión de P53, Rad51C y Xiap podría explicarse por la incapacidad celular para reducir los niveles de estas especies, los cuales interactuarían con el ADN causando rupturas en la doble cadena (43). en tal contexto, el gen P53 detendría el ciclo celular para permitir la activación de los sistemas de reparación, así como el gen Rad51C, molécula clave en la reparación del ciclo celular de células mitóticas por recombinación homóloga en el punto de control S/G (34). En el caso del gen Xiap, que también se sobreexpresó al usar el tratamiento con t-BUOOH, la explicación podría ser que, pese al daño causado por las especies reactivas del oxígeno, la célula evadiría la muerte celular, lo cual tendría relación con los resultados de viabilidad (85 %) después del tratamiento obtenidos al tratar las células.

En concordancia con estos resultados, Westerink, et al., encontraron una inducción de luminiscencia dos veces mayor que en el control, en ensayos de genes reporteros en Rad51C, P53 y el CST3, este último con funciones biológicas similares a las del Xiap, ya que ambos suprimen la apoptosis al inhibir la caspasa 3 (9,38). El gen Xiap también se sobreexpresó como reacción al tratamiento con B(a)P, compuesto perteneciente a la familia de los hidrocarburos aromáticos policíclicos. La exposición humana a este compuesto de cinco anillos se produce principalmente por el consumo de tabaco, la inhalación de aire contaminado y la ingestión de alimentos o agua contaminados por efluentes de combustión.

El B(a)P es conocido por ser citotóxico, y por tener propiedades mutagénicas y carcinógenas, y está clasificado como un carcinógeno humano por la International Agency for Research on Cancer (IARC) (44). La sobreexpresión de Xiap con este tratamiento podría indicar que, pese a los daños causados, la célula evade la muerte celular dependiente de caspasas. En su estudio, Westerink, et al., encontraron que B(a)P produjo una inducción de luminiscencia del CST3 cuatro a cinco veces mayor que el control debida a la capacidad del producto de este gen para inhibir la caspasa 3, lo cual podría relacionarse con el resultado de este estudio, dado que el Xiap también es inhibidor de la caspasa 3 (9,38).

Las células tratadas con los extractos R001 y T028 sobreexpresaron los genes Xiap y P53, resultados que se relacionan con las categorías de daño de las células en el ensayo del efecto genotóxico (2 y 1, respectivamente), y pueden deberse a eventos celulares descritos anteriormente. Sin embargo, debe tenerse en cuenta que se desconoce el mecanismo de acción de los extractos y, hasta no aislar el metabolito responsable de estos resultados y dilucidar su estructura química, no se podrán involucrar en los procesos de control del ciclo celular, la reparación del ADN, la inhibición de la apoptosis, la desintoxicación celular o el equilibrio de oxidorreducción.

Según los resultados del estudio, debe tenerse en cuenta que las concentraciones de los extractos evaluadas en las pruebas de los efectos mutagénico y genotóxico en HepG2 fueron las CC50, en tanto que las CI50 anti-Plasmodium utilizadas en la expresión del gen Xiap fueron 3,98, 27,12, 9,69 y 22,8 veces menores en R001, T002, T015 y T028, respectivamente, que las CC50 obtenidas en los ensayos de evaluación del efecto citotóxico.

En este sentido, y dado que el efecto mutagénico fue débil y el daño genotóxico fue de categorías 1 y 2, puede inferirse que los compuestos mutagénicos y genotóxicos y los extractos anti-Plasmodium sin sobreexpresión de los genes evaluados, pudieron deberse a que el protocolo experimental no tuvo en cuenta el tiempo de reparación de las células HepG2, ni las fases del ciclo celular, ni otros genes específicos de estas fases, como las ciclinas G1, S y M (45), o que participan en vías de reparación diferentes a la recombinación homóloga, como la reparación por escisión de nucleótidos y fusión no homóloga de extremos (46). Por consiguiente, se requiere un protocolo experimental que tenga en cuenta estos aspectos, además de evaluar la expresión de los genes seleccionados en diferentes intervalos de tiempo y con las mismas concentraciones de las sustancias en las diferentes pruebas para, así, garantizar su inocuidad. De esta manera se haría un aporte al desarrollo de nuevos antipalúdicos y se avalaría la utilidad de medir la expresión génica al evaluar la seguridad toxicológica.

También, cabe resaltar que en este trabajo las pruebas fueron in vitro y que los ensayos in vivo son necesarios en la fase preclínica del desarrollo de medicamentos, con el fin de garantizar la seguridad toxicológica de los extractos anti-Plasmodium.

Es importante anotar que la sobreexpresión del gen Xiap en las células HepG2 tratadas con t-BUOOH sugiere que este compuesto puede utilizarse como control positivo en la q-PCR cuando se evalúe la seguridad toxicológica de sustancias por inhibición de la apoptosis.

Puede concluirse que, con la metodología utilizada, el extracto T002 fue el de mayor actividad anti- Plasmodium (CI50:5,46 μg/ml) en la cepa 3D7 de P. falciparum, y que, en principio, no fue citotóxico en la línea celular HepG2 (CC50:148,05 μg/ml, es decir, 27,12 veces más alta que la CI50 antiplasmódica), y tampoco fue mutágeno cuando la concentración fue de 148,05 μg/ml. Con esta misma concentración causó daño de tipo 1 en el ADN y no indujo una expresión estadísticamente significativa de los genes Rad51C, Xiap, P53 y Nrf2. Por tal razón, es importante continuar el estudio de este extracto para desarrollar un medicamento antipalúdico seguro.

Agradecimientos

Los autores desean dar un especial a agradecimiento a Otoniel Ramírez, indígena cubeo que realizó el trabajo etnobotánico en las comunidades indígenas del Vaupés para la selección de las plantas con actividad antipalúdica; a Isabel Cristina Ortiz, por el asesoramiento en las pruebas de los efectos mutagénico y genotóxico; y a Gustavo Adolfo Blandón, investigador del grupo PECET, por su acompañamiento en todo lo relacionado con la PCR en tiempo real.

Conflicto de intereses

Los autores manifiestan no haber tenido ningún conflicto de intereses en ninguna de las fases de este estudio.

Financiación

Este trabajo fue financiado por Colciencias (código 1115-489-25104 RC 506-2009) y por la Universidad de Antioquia a través de la estrategia de sostenibilidad, 2014-2015.

Referencias

1. World Health Organisation. World malaria report, 2014. Fecha de consulta: 14 de junio de 2016. Disponible en: http://www.who.int/malaria/publications/world_malaria_ report_2014/report/en/

2. Gligorijevic B, Purdy K, Elliott DA, Cooper RA, Roepe PD. Stage independent chloroquine resistance and chloroquine toxicity revealed via spinning disk confocal microscopy. Mol Biochem Parasitol. 2008;159:7-23. https://doi.org/10.1016/j.molbiopara.2007.12.014

3. Ramírez MO, Cardona NF, Pabón VA, Blair TS. Etno- botánica de las plantas antimaláricas del Vaupés Medio: recuperación del saber médico tradicional. Actu Biol. 2012; 34:154.

4. Dike IP, Obembe OO, Adebiyi FE. Ethnobotanical survey for potential anti-malarial plants in south-western Nigeria. J Ethnopharmacol. 2012;144:618-26. https://doi.org/10.1016/j. jep.2012.10.002

5. Murambiwa P, Masola B, Govender T, Mukaratirwa S, Musabayane CT. Anti-malarial drug formulations and novel delivery systems: A review. Acta Trop. 2011;118:71-9. https://doi.org/10.1016/j.actatropica.2011.03.005

6. Oksman-Caldentey K-M, Inzé D. Plant cell factories in the post-genomic era: New ways to produce designer secondary metabolites. Trends Plant Sci. 2004;9:433-40. https://doi.org/10.1016/j.tplants.2004.07.006

7. Pabón A, Ramírez O, Ríos A, López E, de Las Salas B, Cardona F, et al. Antiplasmodial and cytotoxic activity of raw plant extracts as reported by knowledgeable indigenous people of the Amazon region (Vaupés Medio in Colombia). Planta Med. 2016;82:717-22. https://doi.org/10.1055/s-0042-104283

8. S. Flückiger-Isler MK. The Ames MPFTM 98/100 assay: Novel mutagenicity testing in liquid microplate format using S. typhimurium TA98 and TA100. Gewerbestrasse: Xenometrix; 2006.

9. Westerink WM, Stevenson JC, Horbach GJ, Schoonen WG. The development of RAD51C, Cystatin A, p53 and Nrf2 luciferase-reporter assays in metabolically competent HepG2 cells for the assessment of mechanism-based genotoxicity and of oxidative stress in the early research phase of drug development. Mutat Res. 2010;696:21-40. https://doi.org/10.1016/j.mrgentox.2009.12.007

10. García-Huertas P, Pabón A, Arias C, Blair S. Evaluación del efecto citotóxico y del daño genético de extractos estandarizados de Solanum nudum con actividad anti-plasmodial. Biomédica. 2013;33:78-87. https://doi.org/10.7705/biomedica.v33i1.838

11. Mayence A, Vanden-Eynde JJ, Kaiser M, Brun R, Yarlett N, Huang TL. Bis(oxyphenylene)benzimidazoles: A novel class of anti-Plasmodium falciparum agents. Bioorg Med Chem. 2011;19:7493-500. https://doi.org/10.1016/j.bmc.2011.10.039

12. Maron DM, Ames BN. Revised methods for the Salmonella mutagenicity test. Mutat Res. 1983;113:173-215. https://doi.org/10.1016/0165-1161(83)90010-9

13. Flückiger-Isler S, Kamber M. Direct comparison of the Ames microplate format (MPF) test in liquid medium with the standard Ames pre-incubation assay on agar plates by use of equivocal to weakly positive test compounds. Mutat Res. 2012;747:36-45. https://doi.org/10.1016/j.mrgentox.2012.03.014

14. Platel A, Gervais V, Sajot N, Nesslany F, Marzin D, Claude N. Study of gene expression profiles in TK6 human cells exposed to DNA-oxidizing agents. Mutat Res. 2010;689:21-49. https://doi.org/10.1016/j.mrfmmm.2010.04.004

15. Singh NP, McCoy MT, Tice RR, Schneider EL. A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res. 1988;175:184-91. https://doi.org/10.1016/0014-4827(88)90265-0

16. Zúñiga-Venegas LA, Creus-Capdevila A, Marcos-Dauder R. Optimizaciones metodológicas del ensayo del cometa y su aplicación en biomonitorización humana. Barccelona: Universitat Autònoma de Barcelona; 2009.

17. Guilherme S, Gaivão I, Santos MA, Pacheco M. European eel (Anguilla anguilla) genotoxic and pro-oxidant responses following short-term exposure to Roundup--a glyphosate-based herbicide. Mutagenesis. 2010;25:523-30. https://doi.org/10.1093/mutage/geq038

18. Rodrigues CD, Hannus M, Prudêncio M, Martin C, Gonçalves LA, Portugal S, et al. Host scavenger receptor SR-BI plays a dual role in the establishment of malaria parasite liver infection. Cell Host Microbe. 2008;4:271-82. https://doi.org/10.1016/j.chom.2008.07.012

19. Verma N, Pink M, Rettenmeier AW, Schmitz-Spanke S. Benzo[a]pyrene-mediated toxicity in primary pig bladder epithelial cells: A proteomic approach. J Proteomics. 2013; 85:53-64. https://doi.org/10.1016/j.jprot.2013.04.016

20. Chen M, Gu H, Ye Y, Lin B, Sun L, Deng W, et al. Protective effects of hesperidin against oxidative stress of tert-butyl hydroperoxide in human hepatocytes. Food Chem Toxicol. 2010;48:2980-7. https://doi.org/10.1016/j.fct.2010.07.037

21. Minicucci EM, Ribeiro DA, da Silva GN, Pardini MI, Montovani JC, Salvadori DM. The role of the TP53 gene during rat tongue carcinogenesis induced by 4-nitroquinoline 1-oxide. Exp Toxicol Pathol. 2011;63:483-9. https://doi.org/10.1016/j.etp.2010.03.009

22. Amiri F, Zarnani A-H, Zand H, Koohdani F, Jeddi-Tehrani M, Vafa M. Synergistic anti-proliferative effect of resveratrol and etoposide on human hepatocellular and colon cancer cell lines. Eur J Pharmacol. 2013;718:34-40. https://doi.org/10.1016/j.ejphar.2013.09.020

23. Mukherjee A, Misra S, Howlett NG, Karmakar P. Multi-nucleation regulated by the Akt/PTEN signaling pathway is a survival strategy for HepG2 cells. Mutat Res. 2013;755:135-40. https://doi.org/10.1016/j.mrgentox.2013.06.009

24. Murugaiyan J, Rockstroh M, Wagner J, Baumann S, Schorsch K, Trump S, et al. Benzo[a]pyrene affects Jurkat T cells in the activated state via the antioxidant response element dependent Nrf2 pathway leading to decreased IL-2 secretion and redirecting glutamine metabolism. Toxicol Appl Pharmacol. 2013;269:307-16. https://doi.org/10.1016/j.taap.2013.03.032

25. Das PJ, Paria N, Gustafson-Seabury A, Vishnoi M, Chaki SP, Love CC, et al. Total RNA isolation from stallion sperm and testis biopsies. Theriogenology. 2010;74:1099-106. https://doi.org/10.1016/j.theriogenology.2010.04.023

26. Viegas O, Žegura B, Pezdric M, Novak M, Ferreira IM, Pinho O, et al. Protective effects of xanthohumol against the genotoxicity of heterocyclic aromatic amines MeIQx and PhIP in bacteria and in human hepatoma (HepG2) cells. Food Chem Toxicol. 2012;50:949-55. https://doi.org/10.1016/j.fct.2011.11.031

27. Stephenson FH. Calculations for molecular biology and biotechnology. A guide to mathematics in the laboratory. Second edition. London: Academic Press; 2010. p. 458.

28. Koch A, Tamez P, Pezzuto J, Soejarto D. Evaluation of plants used for antimalarial treatment by the Maasai of Kenya. J Ethnopharmacol. 2005;101:95-9. https://doi.org/10.1016/j.jep.2005.03.011

29. Ahir BK, Pratten MK. Developmental cardiotoxicity effects of four commonly used antiepileptic drugs in embryonic chick heart micromass culture and embryonic stem cell culture systems. Toxicol In Vitro. 2014;28:948-60. https://doi.org/10.1016/j.tiv.2014.04.001

30. Darwish W, Ikenaka Y, Eldaly E, Ishizuka M. Mutagenic activation and detoxification of benzo[a]pyrene in vitro by hepatic cytochrome P450 1A1 and phase II enzymes in three meat-producing animals. Food Chem Toxicol. 2010;48:2526-31. https://doi.org/10.1016/j.fct.2010.06.026

31. Zeiger E. Historical perspective on the development of the genetic toxicity test battery in the United States. Environ Mol Mutagen. 2010;51:781-91. https://doi.org/10.1002/em.20602

32. Rodrigues S, Antunes SC, Correia AT, Nunes B. Acute and chronic effects of erythromycin exposure on oxidative stress and genotoxicity parameters of Oncorhynchus mykiss. Sci Total Environ. 2016;545-546:591-600. https://doi.org/10.1016/j.scitotenv.2015.10.138

33. Madikizela B, Ndhlala AR, Finnie JF, van Staden J. Anti-mycobacterial, anti-inflammatory and genotoxicity evaluation of plants used for the treatment of tuberculosis and related symptoms in South Africa. J Ethnopharmacol. 2014;153:386-91. https://doi.org/10.1016/j.jep.2014.02.034

34. Renglin-Lindh A, Schultz N, Saleh-Gohari N, Helleday T. RAD51C (RAD51L2) is involved in maintaining centrosome number in mitosis. Cytogenet Genome Res. 2007;116:38-45. https://doi.org/10.1159/000097416

35. de Almagro MC, Vucic D. The inhibitor of apoptosis (IAP) proteins are critical regulators of signaling pathways and targets for anti-cancer therapy. Exp Oncol. 2012;34:200-11.

36. Sun M, Meares G, Song L, Jope RS. XIAP associates with GSK3 and inhibits the promotion of intrinsic apoptotic signaling by GSK3. Cell Signal. 2009;21:1857-65. https://doi.org/10.1016/j.cellsig.2009.08.002

37. Boehme K, Dietz Y, Hewitt P, Mueller SO. Activation of P53 in HepG2 cells as surrogate to detect mutagens and promutagens in vitro. Toxicol Lett. 2010;198:272-81. https://doi.org/10.1016/j.toxlet.2010.07.007

38. Bryan HK, Olayanju A, Goldring CE, Park BK. The Nrf2 cell defence pathway: Keap1-dependent and -independent mechanisms of regulation. Biochem Pharmacol. 2013;85:705-17. https://doi.org/10.1016/j.bcp.2012.11.016

39. Klaassen CD, Reisman SA. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver. Toxicol Appl Pharmacol. 2010;244:57-65. https://doi.org/10.1016/j.taap.2010.01.013

40. Stępkowski TM, Kruszewski MK. Molecular cross-talk between the NRF2/KEAP1 signaling pathway, autophagy, and apoptosis. Free Radic Biol Med. 2011;50:1186-95. https://doi.org/10.1016/j.freeradbiomed.2011.01.033

41. Roy A, Sil PC. Taurine protects murine hepatocytes against oxidative stress-induced apoptosis by tert-butyl hydroperoxide via PI3K/Akt and mitochondrial-dependent pathways. Food Chem. 2012;131:1086-96. https://doi.org/10.1016/j.foodchem.2011.09.057

42. Jayakumar S, Pal D, Sandur SK. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells. Mutat Res. 2015;779:33-45. https://doi.org/10.1016/j.mrfmmm.2015.06.007

43. Slamenova D, Kozics K, Hunakova L, Melusova M, Navarova J, Horvathova E. Comparison of biological processes induced in HepG2 cells by tert-butyl hydroperoxide (t-BHP) and hydroperoxide (H2O2): The influence of carvacrol. Mutat Res. 2013;757:15-22. https://doi.org/10.1016/j.mrgentox.2013.03.014

44. International Agency for Research on Cancer -IARC. Some non-heterocyclic polycyclic aromatic hydrocarbons and some related exposures. IARC Monogr. 2010;92:35-773.

45. Cheng T, Scadden DT. Cell cycle regulators in stem cells. In: Lanza R, Atala A, editors. Essentials of Stem Cell Biology. Third edition. Boston: Academic Press; 2014. p. 95-106. https://doi.org/10.1016/B978-0-12-409503-8.00008-1

46. Tyson JJ, Novák B. Irreversible transitions, bistability and checkpoint controls in the eukaryotic cell cycle: A systems-level understanding. In: Walhout AJM, Vidal M, Dekker J, editors. Handbook of Systems Biology. San Diego: Elsevier; 2013. p. 265-85. https://doi.org/10.1016/B978-0-12-385944-0.00014-9

Métricas de artículo

Cargando métricas ...

Metrics powered by PLOS ALM




Revista Biomédica -  https://doi.org/10.7705/issn.0120-4157
ISSN 0120-4157

Instituto Nacional de Salud
INSTITUTO NACIONAL DE SALUD
Avenida Calle 26 No. 51-20
Apartado aéreo 80334 y 80080
Bogotá, D.C., Colombia, S.A.
Teléfono: 05712207700 Ext. 1386
Correo electrónico: biomedica@ins.gov.co