Biomédica 2017;37(Supl.2):83-97

doi: https://doi.org/10.7705/biomedica.v34i2.3536

ARTÍCULO ORIGINAL

Aspectos ecoepidemiológicos, detección natural e identificación molecular de Leishmania spp. en Lutzomyia reburra, Lutzomyia barrettoi majuscula y Lutzomyia trapidoi

Jazzmín Arrivillaga-Henríquez1,2,3, Sandra Enríquez1, Vanessa Romero1,4, Gustavo Echeverría1, Jorge Pérez-Barrera1, Ana Poveda1,5 , Juan-Carlos Navarro6 , Alon Warburg2,7, Washington Benítez1,8

1 Instituto de Investigación en Salud Pública y Zoonosis, Universidad Central del Ecuador, Quito, Ecuador

2 Programa Prometeo, Secretaría Nacional de Educación Superior, Ciencia, Tecnología e Innovación (SENESCYT), Quito, Ecuador

3 área de Ambiente, Turismo Histórico Cultural, Facultad de Comunicación Social, Universidad Central del Ecuador, Quito, Ecuador

4 Facultad de Ciencias Biológicas, Carrera de Ciencias Biológicas y Ambientales, Universidad Central del Ecuador, Quito, Ecuador

5 Facultad de Ciencias Químicas, Universidad Central del Ecuador, Quito, Ecuador

6 Laboratorio de Biodiversidad y Salud Ambiental, Facultad de Ciencias Naturales y Ambientales, Universidad Internacional SEK, Quito, Ecuador

7 Faculty of Medicine, Department of Microbiology and Molecular Genetics; Institute of Medical Research  Israel-Canada; Kuvin Center for the Study of Infectious and Tropical Diseases, Hebrew University of  Jerusalem, Jerusalem, Israel

8  Facultad de Medicina Veterinaria y Zootecnia, Universidad Central del Ecuador, Quito, Ecuador

Contribución de los autores:

Jazzmín Arrivillaga-Henríquez: diseño de la investigación, trabajo de campo, identificación de los flebotomíneos, identificación, análisis e interpretación de la secuencias de Leishmania, análisis e interpretación de variables ecoepidemiológicas, y escritura del manuscrito

Sandra Enríquez: coordinación logística, análisis de la base de datos ecológicos, trabajo de campo y revisión crítica del documento

Vanessa Romero y Gustavo Echeverría: extracción de ADN, estandarización del protocolo de extracción, amplificación por reacción en cadena de la polimerasa del gen ITS1 de Leishmania

Jorge Pérez-Barrera: amplificación de genes de la topoisomerasa

Ana Poveda: diseños de oligonucleótidos, amplificación, secuenciación y caracterización de las secuencias de las topoisomerasas y escritura del manuscrito

Juan Carlos Navarro: análisis filogenéticos y escritura del manuscrito

Alon Warburg: trabajo de campo y secuenciación de los amplicones de ITS1 de Leishmania

Washington Benítez: coordinación del proyecto y escritura del manuscrito

Recibido: 09/08/16; aceptado: 27/06/17


Introducción. La provincia de Pichincha, Ecuador, es un área endémica de leishmaniasis cutánea, en donde se han determinado como vectores los flebotomíneos antropofílicos con infección natural por Leishmania spp. Sin embargo, no se ha evaluado el papel en la transmisión de las especies zoofílicas.

Objetivo. Evaluar la infección natural por Leishmania en dos especies de flebotomíneos zoofílicos, Lutzomyia reburra y Lu. barrettoi majuscula, y en una antropofílica, Lu. trapidoi, así como la endofagia y la sinantropía de estas especies en el noroccidente de Pichincha.

Materiales y métodos. Los flebotomíneos se recolectaron en trampas de luz CDC colocadas en diferentes hábitats y altitudes en sitios que son focos de leishmaniasis cutánea. La infección con Leishmania spp. se detectó en el ADN genómico de hembras de las especies de flebotomíneos de interés. Se amplificó el gen espaciador interno de la transcripción del ARN ribosómico, unidad I (ITS1), y los genes de las topoisomerasas mitocondrial II (mtTOPOII) y nuclear II (TopoII). Se determinaron los porcentajes de positividad para Leishmania a escala espaciotemporal, la proporción de endofagia y el índice de sinantropía.

Resultados. Se determinó la presencia de infección natural por Le. amazonensis en Lu. reburra (9,5 %) y Lu. b. majuscula (23,8 %); en Lu. trapidoi se detectaron Le. amazonensis, Le. brazilienis y Le. naiffilainsoni. Los flebotomíneos eran asinantrópicos y con baja endofagia.

Conclusión. Se registró por primera vez la presencia de infección natural en Lu. reburra y Lu. barrettoi majuscula por Le. amazonensis, y se demostró la importancia de los flebotomíneos zoofílicos en el mantenimiento del ciclo de transmisión de Leishmania spp. en focos endémicos.

Palabras clave: Psychodidae; Leishmania; leishmaniasis cutánea; reacción en cadena de la polimerasa; Ecuador.

doi: https://doi.org/10.7705/biomedica.v34i2.3536


Eco-epidemiological aspects, natural detection and molecular identification of Leishmania spp. in Lutzomyia reburra, Lutzomyia barrettoi majuscula and Lutzomyia trapidoi

Introduction: The province of Pichincha in Ecuador is an endemic area of cutaneous leishmaniasis, where anthropophilic sand flies with natural infection by Leishmania, have been reported as vectors. However, the role in transmission of zoophilic species has not been evaluated.

Objective: To evaluate natural infection by Leishmania in two zoophilic phlebotomine sand fly species,Lutzomyia reburra and Lu. barrettoi majuscula, and one anthropophilic species, Lu. trapidoi, as well as the endophagy and synanthropism of these species in the northwest of Pichincha.

Materials and methods: Phlebotomines were collected using CDC light traps in different habitats and altitudes with presence of cutaneous leishmaniasis. Leishmania infection was detected using genomic DNA from females of the collected sand flies. We amplified the internal transcribed spacer gene of ribosomal RNA I (ITS1), the mitochondrial topoisomerase II gene (mtTOPOII), and the nuclear topoisomerase II gene (TopoII). Percentages of positivity for Leishmania, at spatio-temporal scale, proportion of endophagy and synanthropism index were calculated.

Results: Natural infection was determined for Le. amazonensis in Lu. reburra (9.5%) and Lu. b.majuscula (23.8%), while in Lu. trapidoi we detected Le. amazonensis, Le. brazilienis and Le. naiffilainsoni. Phlebotomines were asynanthropic and with low endophagy.

Conclusion: Natural infection with Le. amazonensis was recorded for the first time in Lu. reburra and Lu. b. majuscula, demonstrating the importance of zoophilic phlebotomines in the maintenance of the Leishmania transmission cycle in endemic foci.

Key words: Psychodidae; Leishmania; leishmaniasis, cutaneous; polymerase chain reaction; Ecuador.

doi: https://doi.org/10.7705/biomedica.v34i2.3536


La diversidad de flebotomíneos en Ecuador se ha estudiado en localidades geográficas que son focos activos de transmisión de leishmaniasis cutánea (1-3). La región geográfica de la Sierra, en el noroccidente de la Provincia de Pichincha, es una de las áreas geográficas de mayor riqueza en flora y fauna (4). No obstante, ha sufrido un considerable desarrollo urbanístico en las últimas décadas (5) y muchas de sus zonas se han visto afectadas por el cambio de uso de la tierra, lo cual ha resultado en su caracterización epidemiológica como zonas endémicas de leishmaniasis cutánea (6,7).

Las especies de flebotomíneos dominantes en estas zonas, Lutzomyia (Nyssomyia) trapidoi (Fairchild y Hertig), Lu. (Helcocyrtomyia) hartmanni (Fairchild y Hertig), Lu. (Lutzomyia) gomezi (Nitzulescu), Lu. (Pshychodopygus) panamensis (Shannon) y Lu. (Helcocyrtomyia) ayacuchensis (Cáceres y Galati), presentan una gran actividad antropofílica (8-14). Además, se han recolectado en zonas con alteraciones en la ecología del paisaje por la acción de la deforestación debida a la explotación maderera y, recientemente, por el desarrollo agropecuario y turístico y la urbanización de zonas rurales (15).

A pesar de que Lu. trapidoi y Lu. hartmanni son especies antropofílicas (10,14), ocasionalmente se han recolectado en ecosistemas boscosos, cerca de cuevas de armadillos, al igual que Lu. (Trichophoromyia) reburra (Fairchild y Hertig),una especie zoofílica asociada a la región andina. En Colombia, Lu. reburra está asociada a focos de leishmaniasis cutánea en bosques fragmentados, pero hasta el momento no se ha reportado su infección natural por Leishmania (16), lo cual le resta importancia como vector potencial en los estudios ecoepidemiológicos. Otra de las especies recolectadas en cuevas de animales, y asociadas con Lu. trapidoi y Lu. reburra, es Lu. (Aragoi) barrettoi majuscula (Mangabeira),reportada en México como una especie antropofílica (17). Se ha sugerido que en Ecuador esta especie no tiene un comportamiento antropofílico y se asume que es estrictamente zoofílica. La abundancia de estas dos especies zoofílicas de flebotomíneos varía, y se ha asociado con focos activos y endémicos de leishmaniasis cutánea (6-14).

Los estudios ecológicos en focos de transmisión activa de leishmaniasis cutánea en el noroccidente de Pichincha, evidencian que varias especies relativamente abundantes y catalogadas como zoofílicas son dominantes pero epidemiológicamente secundarias comparadas con Lu. trapidoi, vector principal en estos focos(10,13). Sin embargo, no se ha evaluado la presencia de infección natural por Leishmania spp. en algunas de estas especies zoofílicas.

Según el contexto ecoepidemiológico, la tasa de infección natural en flebotomíneos debe evaluarse en diferentes escalas espaciales, ya que su distribución espacial no es homogénea. Esta aproximación espacio-temporal de la infección natural permite reconocer patrones clave en el riesgo y la vulnerabilidad a la infección por agentes patógenos en una zona geográfica donde el vector incriminado o potencial está presente (18-20), y hacer una valoración rápida de los focos de transmisión y las zonas de riesgo.

En este estudio, la hipótesis que se plantea es que las especies de flebotomíneos zoofílicas, principalmente aquellas que están asociadas a cuevas de pequeños mamíferos silvestres incriminados como reservorios potenciales, son sensibles a la infección por Leishmania spp. y tienen un papel clave en la circulación de especies de Leishmania en focos de gran endemia de leishmaniasis cutánea.

En la detección molecular de Leishmania spp. y su tipificación en flebotomíneos, se han empleado el gen citocromo b (Cyt b) y la subunidad pequeña ribosómica de la región del ARN (SSU-rRNA) (21). En el presente trabajo, se utilizó el gen espaciador interno de la transcripción del ARN ribosómico, unidad I (ITS1), propuesto recientemente para una detección más sensible de Leishmania spp. que otros marcadores (22), en especial, cuando se debe detectar de forma rápida la leishmaniasis cutánea (23) y genotipificar especies neotropicales del parásito (24).

Por otra parte, aunque las topoisomerasas no se han empleado para la detección de infección natural por Leishmania spp. con fines de diagnóstico y diferenciación taxonómica, en una revisión reciente se analizó su potencial como blanco molecular para el desarrollo de soluciones terapéuticas. Las topoisomerasas tienen un papel esencial como moduladoras de la topología del ADN mediante el control del grado de ‘superenrollamiento’ del ADN o la eliminación de nudos generados durante procesos celulares como la replicación, la transcripción o la reparación. Se han establecido dos familias de topoisomerasas, las de tipo I y las de tipo II, cuyo mecanismo de acción difiere, lo cual podría tener un valor agregado de diferenciación taxonómica en Leishmania spp. dada su variabilidad genética (25,26).

El objetivo general del presente estudio fue evaluar la infección natural por Leishmania spp. en dos especies de flebotomíneos zoofílicos, Lu. reburra y Lu. barrettoi majuscula, y en una especie antropofílica, Lu. trapidoi, a escala espacio-temporal, así como caracterizar y evaluar la congruencia en la identificación de Leishmania spp. en flebótomos mediante elempleo de un fragmento del gen de la topoisomerasa II mitocondrial (mtTOPOII) y del gen de la topoisomerasa II nuclear (TOPOII) paralelamente con la región ITS-1.

Materiales y métodos

área de estudio

Los ejemplares se recolectaron en cinco localidades: Milpe (MI), Mashpi (MS), Pedro Vicente Maldonadovía el Progreso (PVM), Puerto Rico-Puerto Quito (PR) y La Isla (I), ubicadas en áreas endémicas de leishmaniasis cutánea en el noroccidente de la provincia de Pichincha (cuadro 1, figura 1). Las localidades se encuentran en dos áreas  biogeográficas, el Chocó ecuatoriano y la cordillera Occidental, en donde hay parches de bosque primario húmedo tropical, pero ha habido cambios en el uso de la tierra, principalmente por la actividad agropecuaria y la urbanización de zonas rurales (27).

Las condiciones climáticas de las cinco localidades son similares (28), con variaciones térmicas diarias entre los 17 y los 25 °C, altos niveles de precipitación entre los meses de mayo y julio (260 a 320 mm), y mínimos, entre agosto y marzo (140 a 220 mm); mayo es el mes de mayor precipitación promedio (320 mm), en tanto que en agosto la precipitación es intermedia (220 mm), y en noviembre se registra la menor (190 mm).

Recolección de los flebotomíneos

La recolección se hizo con trampas CDC de luz blanca (27 trampas durante tres noches por localidad y por mes entre las 18:00 y las 06:00 horas), durante los meses de julio y agosto de 2013 y mayo de 2014. Se hicieron tres muestreos: uno para evaluar la infección natural y los otros dos para estudiar los aspectos ecoepidemiológicos de sinantropía y endofagia. Las trampas se ubicaron en cuatro tipos de hábitats: vivienda (intradomicilio), peridomicilio (3 a 60 m de distancia de la vivienda), bosque (el  más cercano a la vivienda) y cultivos (papa china,  yuca, plátano o cacao), en un gradiente altitudinal de 122 a 1.200 msnm (cuadro 1) dividido en tres categorías: alta (1.200 m), intermedia (500 a 558 m) y baja (122 a 329 m). Las hembras de flebotomíneos que se posaban sobre los investigadores durante la revisión nocturna de las trampas, se recolectaron con aspiradores manuales.

Identificación de los flebotomíneos

Los ejemplares se separaron individualmente por sexo. Se utilizó la clave taxonómica de Young, et al. (14). Las hembras identificadas como Lu. reburra, Lu. trapidoi y Lu. barrettoi majuscula con base en las características del cibario y los genitales, se seleccionaron para la detección molecular de Leishmania spp.

Extracción del ADN de los flebotomíneos

Los ejemplares de flebotomíneos almacenados de forma individual en tubos de 1,5 ml a –80 °C, se hidrataron durante 24 horas a temperatura ambiente en 300 µl de solución tampón de hidratación (100 mM de Tris-HCl, 50 mM de EDTA, 100 mM de NaCl, SDS al 0,5 %, 200 mM de sacarosa), según el protocolo de Golczer, et al. (29). Para la extracción del ADN se siguió el protocolo de Echeverría, et al. (30). Las modificaciones consistieron en agregar 20 µl de proteinasa K en 100 µl de la solución tampón de extracción para incubar cada muestra durante una hora a 60 °C y a 1.300 rpm, y luego a 100 °C y a 900 rpm durante 10 minutos. Por último, se centrifugó durante cinco minutos a 13.000 rpm, se descartó el pellet y el sobrenadante se almacenó a –20 °C hasta su posterior amplificación.

Amplificación y secuenciación del ITS1 de Leishmania

Se amplificó el fragmento ITS-1 de Leishmania;se utilizaron los cebadores 100 µM LITSR 5’- CTGG ATCA-TTTTCCGATG - 3’ y L5.8S 5’ - TGATACCAC TTATCG-CACTT - 3’ (22). Como control positivo interno se utilizó ADN de Lu. trapidoi previamente amplificado para Leishmania y, como control positivo externo, extracto de ADN de la cepa MHOM/ BZ/82/BEL21 de Le. mexicana. En la reacción en cadena de la polimerasa (PCR) se emplearon: 25 µl por reacción de solución tampón 5X; 2,5 mM de MgCL; 100 µM de cada cebador; 10 mM de dNTP; 0,2 µl de Taq ADN polimerasa y 3-4 µl de ADN total extraído de los abdómenes de hembras de las tres especies de flebotomíneos con el programa de 40 ciclos de cinco minutos a 95 °C, 30 segundos a 95 °C, 30 segundos a 55 °C, un minuto a 72 °C y 10 minutos a 72 °C. Los amplicones de 300 pb se visualizaron en geles de agarosa al 2 % (w/v). Los productos de la PCR se secuenciaron de forma automatizada y directa por Macrogen, utilizando los mismos oligonucleótidos de la PCR.

Identificación de las secuencias del ITS-1 de Leishmania

Las secuencias de ADN se compararon con las del ITS1 del ADN de Leishmania disponibles en GenBank por identidad genética mediante búsqueda en la Basic Local Alignment Search Tool (BLAST) del National Center for Biotechnology Information (NCBI).

En la segunda fase, las secuencias se alinearon utilizando Clustal W (31) en la aplicación Mac Vector, Inc, ver. 14.5.3 (#9000566 a SCW y JCN) y ajustes manuales. Para el alineamiento basado en homologías, se consideraron valores altos de penalización (15 para la creación y la extensión de las gap). Se utilizaron las siguientes secuencias del ITS1 de Leishmania reportadas en GenBank como referencias de Leishmania neotropicales: Le. amazonensis (gi806777491, kp274862), Le. mexicana (gi577861716), Le. braziliensis-LbrasiL-104 (gi806777492), Le. guyananesis (gi685205147), Le. lainsoni (gi577861646), Le. naiffi-lainsoni42 (gi76577722), Le. panamensis (gi227976411), Le. peruviansis (gi577861653), Le naiffi, Le. sp (gi262652965) y Le. siamens (367461079).

Además, se incluyeron las siguientes secuencias de Leishmania del Viejo Mundo pertenecientes al subgénero Leishmania como grupo externo: Le. tropica (gi577861678), Le. major (gi687045625), Le. donovani (gi577861702)y Le. infantum (gi10303005103).

Como criterio preliminar de diferenciación entre las secuencias de Leishmania spp., se recurrió a un análisis de similitud global mediante el método de unión de vecinos (Neighbor Joining, NJ) (32) y bajo los supuestos del modelo Kimura2P para los cálculos de distancia genética (K2P) mediante el programa PAUP 4.0a149, 2016 (33).

Por último, las secuencias se analizaron con un criterio filogenético, utilizando el análisis de máxima parsimonia derivado de la presencia de datos informativos o sinapomorfias. Los caracteres se trataron con igual ponderación y, posteriormente, se pesaron de nuevo con base en el índice de consistencia recalculada (RCI) mediante una búsqueda heurística de 1.000 réplicas iniciales con barrido de ramas, utilizando la bisección y la reconexión de árboles (Tree Bisection-Reconnection, TBR). Como soporte de los grupos o clados, se utilizó el método de bootstrap con 10 réplicas de adición al azar por 500 ‘pseudorréplicas de remuestreo’, eliminando los caracteres no informativos (34,35).

Amplificación, secuenciación e identificación de las topoisomerasas II mitocondrial y nuclear de Leishmania spp.

El fragmento caracterizado de la topoisomerasa II mitocondrial (mtTOPO II) se amplificó usando los oligonucleótidos LmxM15.1290 - F1 (AAGGA GATGG TGCACTTC; posición a 2.011 pb desde el inicio del gen) y LmxM15.1290-R1 (TCCATGTAG TCCAGGAGT; posición a 2.399 pb desde el inicio del gen). El fragmento mtTOPOII comprende los nucleótidos del 2.097 al 2.389. Con el gen mtTOPOII se evaluaron 26 muestras de ADN extraído de flebotomíneos positivos para Leishmania mediante amplificación previa del ITS1.

Para la amplificación del gen TOPOII se utilizaron los oligonucleótidos LmxM.28.2280 - F1 (AAGC GCAACTTGGTGAACTC), ubicados a 2.101 pb desde el inicio del gen, y LmxM.28.2280 - R1 (ATGAGCCGGGTGAAGATGTA), ubicados a 2.330 pb desde el inicio del gen. Ambos pares de oligonucleótidos se diseñaron en el presente estudio. Para la amplificación se siguieron las instrucciones del fabricante (Invitrogen Taq DNA polymerase), con 25 µl por reacción: solución tampón 1X; 5 mM de MgSO4 ; 0,2 mM de cada cebador; 0,2 mM de dNTP; 0,2 µl de Taq ADN polimerasa, y 3 µl de ADN total extraído de flebótomos positivos para Leishmania spp., según lo determinado en la amplificación de la región ITS-1 con el programa de 40 ciclos de 30 segundos a 95 °C, 30 segundos a 55 °C, y un minuto a 72 °C. Los amplicones se enviaron a Macrogen y se secuenciaron de forma directa con los mismos cebadores de la amplificación.

Las secuencias alineadas y los análisis de similitud global se hicieron bajo los mismos criterios del análisis de la región ITS-1. Sin embargo, las secuencias de mtTOPOII y de TOPOII de las siguientes especies de Leishmania, empleadas como referencia para el análisis, se obtuvieron de la base de datos pública GeneDB (36): Le. infantum (LinJ.15.1310), Le. major (LmjF.15.1290), Le. donovani (LdBPK_151310.1), Le. braziliensis (LbrM.15.1230), Le. mexicana (LmxM.15.1290) y Le. amazonensis (>A20130 |DNA_1 220..3930|.||.|Scaffold871); la secuencia de Leishmania amazonensis se obtuvo de GeneLGE. Sin embargo, no se hicieron análisis de parsimonia debido a la ausencia de sinapomorfias en las secuencias de ADN obtenidas para los dos tipos de topoisomerasas.

Cálculo de porcentaje de positividad para Leishmania

Se calculó el porcentaje de positividad para Leishmania del número total de especies de flebotomíneos y de cada una de ellas en particular por localidad, intervalo de altitud, hábitat y precipitación en el mes de recolección. El porcentaje se calculó estableciendo la proporción del número de hembras positivas con relación al número de hembras procesadas mediante PCR, de manera que si todas las hembras recolectadas se procesaran, el porcentaje de positivas equivaldría a la tasa máxima de infección. Para las muestras en las que no se procesaron todas las hembras recolectadas, este cálculo correspondió a la tasa de infección mínima (37).

Cálculo de la endofagia

El valor de la endofagia para las tres especies de flebotomíneos se calculó, según Santamaria, et al. (9), en función del número de ejemplares capturados en el intradomicilio dividido por el número de ejemplares capturados en el peridomicilio, lo cual indica la proporción de ejemplares del peridomicilio que podrían entrar a la vivienda.

Cálculo de la sinantropía

Se calculó el valor de la sinantropía para las tres especies de flebotomíneos según el método de Figueroa-Roa, et al. (38), modificado para la escala de distribución microespacial del presente trabajo, así: 2 x el porcentaje de ejemplares recolectados en la vivienda + porcentaje de ejemplares recolectados en el peridomicilio – 2 x el porcentaje de ejemplares recolectados en el bosque/2. El índice de sinantropía varía de +100 a -100. Los valores positivos indican que una especie está asociada al ambiente humano, específicamente a las viviendas (intradomicilio), en tanto que los valores negativos indican que las especies evitan este ambiente. Los valores numéricos mínimos son el cero, el valor intermedio es 50 y un valor de 100 representa el máximo valor numérico para este índice, independientemente de su signo.

Análisis estadístico

La asociación entre la variable del porcentaje de positividad para Leishmania en flebotomíneos (total y para cada una de las tres especies estudiadas), y las variables de localidad, hábitat, intervalo de altitud y precipitación por mes de muestreo, se evaluaron mediante la prueba estadística de ji al cuadrado (χ2), usando el programa estadístico SPSS ® , versión 15.0 (39).

Resultados

Diagnóstico molecular de Leishmania

Se recolectaron 26 especies pertenecientes a la subfamilia Phlebotominae en el gradiente altitudinal estudiado (no se presentan los datos). Solo tres especies, Lu. trapidoi, Lu. reburra y Lu. b. majuscula, se seleccionaron para el diagnóstico molecular de la infección natural por Leishmania spp. en hembras procesadas de forma individual que no habían ingerido sangre ni portaban huevos. Lutzomyia trapidoi se seleccionó por ser la especie más abundante durante el muestreo y vector comprobado en el noroccidente de Pichincha. Se procesó el 4 % (124 hembras) de los ejemplares recolectados de esta especie. Lutzomyia reburra se seleccionó por ser una especie dominante y la segunda en abundancia después de Lu. trapidoi en varias de las localidades; se procesaron todos los individuos (50 hembras). Lutzomyia b. majuscula se seleccionó porque ha sido asociada a las cuevas de armadillosy en este estudio fue la especie de mayor abundancia espacial entre aquellas de menor abundancia (1 %); se procesaron todos los individuos (47 hembras).

Se detectó infección por Leishmania en las tres especies de flebotomíneos en función del gen ITS1, evidenciándose la presencia de una banda de 300 pb en la muestra de control (cultivo de Leishmania), similar a la banda amplificada a partir de las muestras del abdomen de las hembras (figura 2).

Porcentaje de positividad para Leishmania a escala espacio-temporal con base en el ITS1

Localidad. Los porcentajes de positividad fueron mayores para el total de flebotomíneos en la localidad de La Isla, y solo las hembras de dos especies estaban infectadas, con un porcentaje de positividad en Lu. reburra mayor que el de Lu. b. majuscula. La siguiente localidad con mayor porcentaje de positividad total fue Milpe, km 91, donde se encontraron tres especies con infección natural; dicho porcentaje fue mayor en Lu. trapidoi, seguido de Lu. reburra y de Lu. b. majuscula. En las localidades de Mashpi, Puerto Rico y Pedro Vicente Maldonado, se obtuvieron porcentajes de positividad asociados a la presencia de una sola especie de flebotomíneo. En Mashpi se encontró Lu. b. majuscula, en tanto que Lu. trapidoi se encontró en las dos últimas localidades mencionadas (figura 3a). Las diferencias en el porcentaje de positividad total por localidad se confirmaron estadísticamente (χ2=15,01; gl=4; p=0,005). Sin embargo, la diferencia en dicho porcentaje por especie en las localidades no fue estadísticamente significativa para ninguna de las especies estudiadas: Lu. trapidoi, Lu. b. majuscula y Lu. reburra (χ2=2,63, gl=4, p=0,652;χ2 = 5,76, gl=4, p=0,214; yχ2=7,82, gl=4, p=0,154, respectivamente).

Hábitat. El mayor porcentaje de positividad total para Leishmania se encontró en el peridomicilio, seguido del intradomicilio, el bosque y los cultivos. En las viviendas se encontraron dos especies positivas para Leishmania: Lu. trapidoi y Lu. reburra. En el peridomicilio y en el bosque, se encontraron las tres especies con infección natural, pero con diferentes porcentajes de positividad. La mayor positividad en el peridomicilio la presentó Lu. b. majuscula y, en el bosque, Lu. trapidoi. En los cultivos, principalmente los de cacao, solo Lu. trapidoi resultó con infección, con un porcentaje de positividad comparativamente bajo (10 % aproximadamente, figura 3b). En general, se observó una tendencia a registrar mayores porcentajes de positividad para Leishmania en los ambientes transformados por el hombre (vivienda y peridomicilio) (figura 3b). Sin embargo, las diferencias en el porcentaje de positividad total por hábitat no fueron confirmadas estadísticamente (χ2 =1,6: gl=3: p=0,67). Asimismo, no se confirmaron estadísticamente las diferencias aparentes entre el porcentaje de positividad por especie de flebotomíneo según el hábitat (Lu. trapidoi: χ2=4,47, gl=3, p=0,21; Lu. reburra: χ2=2,99, gl=2, p=0,25, y Lu. b. majuscula: χ2=3,03, gl=2, p=0,27).

Altitud. En la altitud intermedia (500 a 550 msnm), el porcentaje de positividad para Leishmania se debió a la presencia de dos especies de flebotomíneos con infección natural, Lu. trapidoi y Lu. b. majuscula. En la altitud extrema (1.200 msnm) o en la más baja (122 a 329 msnm), las tres especies se encontraron infectadas con porcentajes de positividad diferentes. En la altitud máxima, la especie con mayor positividad fue L. trapidoi, seguida de Lu. b. majuscula y de Lu. reburra. Por el contrario, en la menor altitud, la especie con mayor positividad fue Lu. b. majuscula seguida de Lu. reburra y de Lu. trapidoi (figura 3c). Las diferencias mencionadas en el porcentaje de positividad total por altitud se confirmaron estadísticamente (χ2 =8,7; gl=2; p=0,01). Sin embargo, por especie de flebotomíneo solo se confirmaron estadísticamente las diferencias en los porcentajes de positividad según la altitud para Lu. reburra (χ2=6,0; gl=2; p=0,05).

Precipitación. En noviembre, el mes de menor precipitación, se registró el mayor porcentaje de positividad total de hembras de dos de las especies: Lu. trapidoi y Lu. reburra. En agosto, mes con niveles intermedios (220 mm) de precipitación, se registró el segundo mayor porcentaje de positividad total para Leishmania en las tres especies, siendo el porcentaje de positividad de Lu. b. majuscula mayor que el de Lu. trapidoi y Lu. reburra. Por el contrario, en mayo, el mes de mayor precipitación, con 320 mm, la única especie recolectada en la que se encontró infección por Leishmania fue Lu. reburra (figura 3d). Las diferencias mencionadas entre las variables del porcentaje de positividad total y la precipitación, se confirmaron estadísticamente (χ2 =11,5; gl=2; p<0,001). Sin embargo, las diferencias en el porcentaje de positividad por especie de flebotomíneo en relación con la precipitación no fueron estadísticamente significativas (Lu. trapidoi: χ2 =2,37, gl=2, p=0,41; Lu. reburra: χ2=0,59, gl=2, p=1,0; Lu. b. majuscula: χ2 =0,91, gl=2, p=1,0).

Identificación molecular de Leishmania con base en el fragmento ITS-1

Los análisis de las secuencias del ITS1 permitieron tipificar bajo un criterio filogenético la determinación taxonómica de tres especies de Leishmania. La primera correspondió a Le. amazonensis,la especie de parásito más abundante (83 %), presente en Lu. reburra, Lu. barrettoi majuscula y Lu. trapidoi. El árbol filogenético evidenció la existencia de una politomía en el nodo D, y no se encontraron linajes en la especie Le. amazonensis, independientemente de la localidad muestreada y de la especie de flebotomíneo (figura 4).

Leishmania braziliensis (4,7 %) se detectó en la localidad de Puerto Rico, y se determinaron filogenéticamente dos secuencias diferentes sin divergencia nucleotídica, lo cual indica que pertenecen a un mismo grupo monofilético, representado por el nodo B21. Una tercera especie de Leishmania se detectó en la localidad de Milpe con base en una sola secuencia amplificada, y se identificó como Le. naiffi-Le. lainsoni (2,3 %) por su identidad con  la secuencia de referencia del Genbank agrupada en el nodo B22. Las dos especies de Leishmania detectadas solo se encontraron en Lu. trapidoi (figura 4 y figura 5).

Identificación de Leishmania con base en el fragmento de mtTOPOII

El 61,5 % de las muestras seleccionadas a partir de aquellas positivas con base en el ITS1, y amplificadas con base en el mtTOPOII, correspondieron a 16 secuencias de 292 pb pertenecientes a las tres especies de flebotomíneos (figura 6a). El análisis de similitud global (NJ) evidenció que 15 de las 16 secuencias obtenidas eran idénticas y pertenecían a un mismo haplogrupo del subgénero Leishmania,y se asociaban específicamente por similitud global con secuencias de Le. amazonensis (figura 6a). Una secuencia del mtTOPOII, amplificada a partir de una muestra de Lu. trapidoi y denominada como secuencia MT107, se asoció al grupo del subgénero Viannia y se identificó como Le. braziliensis (figura 6a).

Identificación de Leishmania con base en el fragmento TOPOII

En el análisis de similitud global se evidenció que todas las 13 secuencias analizadas de este gen fueron idénticas y pertenecían a un genotipo distinto del de las secuencias de Le. mexicana presentes en el grupo del subgénero Leishmania. Las secuencias se tipificaron como Le. amazonensis con base en el ITS1 y la topoisomerasa mtTOPOII. Sin embargo, no se observaron cambios en la secuencia de aminoácidos de la proteína, en contraste con las secuencias obtenidas para mtTOPOII, en las cuales la  variación nucleotídica del gen se tradujo en cambios en las secuencias de aminoácidos de la topoisomerasa mitocondrial (no se muestran los datos) (figura 6b).

Los resultados de la identificación por similitud global de una secuencia de Leishmania denominada como MT110 y detectada en un ejemplar de Lu. trapidoi recolectado en Puerto Rico, no fueron congruentes.

Los análisis con el ITS1 mostraron que esta secuencia es cercana filogenéticamente a Le. naiffi Le. braziliensis, en tanto que, con base en la mtTOPOII, se agrupó con Le. amazonensis (figura 5b). Por esta razón, no se la incluyó en los análisis de tipificación de Leishmania a la espera de otros análisis.

Endofagia. El valor más alto de endofagia (0,38) se obtuvo para Lu. reburra (24/62 individuos, intradomicilio/peridomicilio), seguido por Lu. trapidoi (0,15) (57/370), en tanto que para Lu. b. majuscula, dicho valor fue de cero (0/10).

Sinantropía. Todas las especies resultaron ser asinantrópicas con respecto al área de la vivienda, pues los valores fueron negativos. Sin embargo, Lu. reburra presentó el valor menos negativo (-10,1) comparado con los de Lu. b. majuscula (-72,7) y Lu. trapidoi (-69,3).

Discusión

Se detectó Leishmania en Lu. reburra, Lu. barettoi majuscula y Lu. trapidoi mediante el análisis concordante de ITS1, mtTOPOII y TOPOII, lo cual evidencia el potencial de las topoisomerasas para la tipificación de la infección natural por Leishmania  en flebotomíneos.

Los porcentajes de positividad para Leishmania fueron significativamente altos en cada especie, siendo comparables con los de Leishmania en flebotomíneos neotropicales, los cuales oscilan entre 6,9 y 92,8 %. En el caso de Lu. reburra y Lu. barrettoi majuscula, los valores del porcentaje de positividad correspondieron a la tasa de infección máxima, es decir, 12 y 31,1 %, respectivamente, ya que se procesaron todas las hembras recolectadas de forma individual. Por el contrario, los porcentajes de positividad de Lu. trapidoi correspondieron a la tasa mínima de infección natural debido a que solo se procesó el 4 % de las hembras; los valores de infección natural encontrados estuvieron dentro del intervalo de tasa mínima de infección para el diagnóstico molecular en flebotomínos neotropicales, principalmente los antropofílicos, la cual oscila entre 0,06 y 3,9 % (8-13,37,40-45).

Los altos valores de positividad registrados en el presente estudio podrían explicarse por la gran diversidad de la fauna silvestre que puede servir de reservorio en el Chocó ecuatoriano, al cual pertenece biogeográficamente la región del noroccidente de Pichincha, donde, a pesar del grado de intervención de los bosques, hay una diversidad comparativamente mayor a la de otros focos de las zonas andinas (15), lo que favorece el solapamiento del nicho ecológico espacio-temporal de los flebotomíneos y los huéspedes potenciales de Leishmania. La ausencia de una estacionalidad acentuada de las variables de precipitación y temperatura, con la presencia de periodos largos (ocho meses) de poca precipitación mensual (149 a 220 mm) y periodos cortos (cuatro meses) de alta precipitación mensual (240 a 320 mm), favorece la persistencia de las poblaciones de estos tres flebotomínos en la zona de muestreo, siendo la precipitación una variable macroclimática aparentemente importante para la dinámica de transmisión de la leishmaniasis (20).

En el noroccidente de Pichincha, la circulación de las especies detectadas de Leishmania se da entre los meses de agosto y mayo, lo que equivale, por lo menos, a una presencia de Leishmania durante 83,3 % del año. Desde el punto de vista ecoepidemiológico, noviembre es el mes de máxima positividad para Leishmania y, en consecuencia, la máxima transmisión debería registrarse antes del inicio del periodo de mayor precipitación, cuando la abundancia de hembras infectadas baja significativamente.

La mayor abundancia de hembras positivas se asoció, aparentemente, a los ambientes con actividad de construcción de vivienda, lo que sugiere un ciclo doméstico de transmisión asociado a la vivienda rural, principalmente en el peridomicilio. De ahí la necesidad de adoptar medidas de prevención y control de vectores en este hábitat. Sin embargo, este mayor riesgo de picaduras infectivas en el intradomicilio debe confirmarse, pues no se encontraron diferencias estadísticamente significativas entre el porcentaje de positividad para Leishmania y la variable de hábitat.

La detección molecular de la infección natural en Lu. trapidoi, con una positividad para Leishmania de 23,3 %, evidenció el papel de esta especie como vector en la región de la sierra ecuatoriana (2,7,13) donde Lu. trapidoi se ha encontrado con infección natural por Le. panamensis, Le. naiffi, Le. guyanensis y Le. panamensis/guyanensis (6-7,13).

En el presente trabajo se encontró infección natural con tres especies de Leishmania pertenecientes a dos subgéneros: Leishmania (Le. amazonensis) y Viannia (Le. braziliensis y Le. naiffi-lainsoni), especies detectadas por primera vez en Lu. trapidoi, lo cual es indicativo de su papel como vector potencial. Además, este resultado representa el primer registro de Le. amazonensis en la sierra ecuatoriana, pues antes solo se había registrado en la región de la costa ecuatoriana (7,13).

Asimismo, se registra por primera vez en Ecuador la presencia del híbrido de Leishmania Le. naiffilainsoni, lo cual sugiere la circulación de Le. naiffi y Le. lainsoni en el noroccidente de Pichincha (21), especies estas registradas previamente solo en la Amazonia ecuatoriana, y explicaría por qué la región de la sierra es una zona ecológica para el intercambio genético entre estas especies de Leishmania (43).

Leishmania braziliensis se ha encontrado en la provincia de Pichincha en pacientes con leishmaniasis cutánea en las localidades de San Miguel de Los Bancos, Puerto Quito y Pedro Vicente Maldonado; esta especie se había registrado ya en la Amazonia y en la costa ecuatoriana (21). En el presente estudio, se detectó en ejemplares de Lu. trapidoi recolectados en la localidad de Puerto Rico. Así, se propone a Lu. trapidoi como el vector primario de Le. braziliensis en la provincia de Pichincha, región de la sierra, dada la presencia, en esta misma zona, de casos clínicos de leishmaniasis en humanos causados por la misma especie de Leishmania.

Además, se detectó por primera vez la infección natural por Le. amazonensis en Lu. reburra y Lu. b. majuscula, siendo la especie de mayor abundancia en la zona de muestreo; se detectó, asimismo,en Lu. trapidoi con un alto porcentaje de infección (59,5 %), lo cual evidencia la importancia de este flebotomíneo como vector primario debido a su dominancia, antropofilia y amplia distribución espacial en el gradiente altitudinal en aquellos focos más activos y de mayor incidencia de leishmaniasis cutánea, como Pedro Vicente Maldonado (PVM-vía El Progreso) y Puerto Quito (Puerto Rico).

En cuanto a los valores de endofagia y sinantropía, y a la amplia presencia de los flebotomíneos con infección por Le. amazonensis, Lu. trapidoi presentó valores significativamente menores en comparación con Lu. reburra, lo cual sugiere que constituye un vector potencial secundario de Le. amazonensis dado su porcentaje de positividad (9,5 %), una presencia más prolongada de hembras infectadas (40 %) en las localidades, y su comportamiento zoofílico y antropofílico (se recolectaron hembras de forma incidental durante los muestreos de Lu. trapidoi).

Lutzomyia reburra se encontró en gran abundancia en las localidades de Milpe y La Isla. En Milpe, la incidencia de leishmaniasis cutánea en humanos ha sido menor que en Pedro Vicente Maldonado y Puerto Quito (7). Por el contrario, en la localidad de La Isla no se han registrado casos de leishmaniasis cutánea según los informes de la propia comunidad en las encuestas sobre conocimientos, aptitudes y prácticas en torno a la leishmaniasis. Así, se registró circulación de Le. amazonensis sin que, aparentemente, se hayan dado casos clínicos en humanos asociados a esta especie en el noroccidente de Pichincha (21).

Por otro lado, a pesar de que las hembras infectadas de Lu. b. majuscula presentaron un mayor porcentaje de positividad para Le. amazonensis (23,8%) que Lu. reburra (9,5 %), su importancia vectorial posiblemente se restringe a un periodo específico, ya que solo se recolectaron adultos en agosto, durante el periodo de menor precipitación.

Desde el punto de vista espacial, las hembras infectadas de Lu. b. majuscula se encontraron en 60 % de las localidades muestreadas, principalmente en el peridomicilio y en el bosque, y con un comportamiento de picadura exofílico y exofágico, derivado de su preferencia por alimentarse con sangre de animales silvestres, lo cual la cataloga como zoofílica, al menos en las localidades estudiadas.

Los resultados de este estudio sugieren la existencia de dos ciclos de transmisión de Le. amazonensis  en la sierra ecuatoriana. El primero es un ciclo enzoótico, mantenido potencialmente por, al menos, tres especies de flebotomínos: 1) Lu. trapidoi, vector primario si se atiende a su abundancia relativamente alta, a la elevada tasa de infección natural, a su dominancia y a la amplia distribución espaciotemporal en el noroccidente de Pichincha; 2) Lu. reburra, vector secundario debido a su menor dominancia, la amplitud intermedia de su distribución espacial, y a la mayor presencia espacial de hembras infectadas comparada con Lu. Trapidoi, y 3) Lu. b. majuscula,vector terciario según su tasa de infección natural, menor distribución espaciotemporal y solapamiento con Lu. trapidoi y Lu. reburra en el mes de mayor porcentaje de positividad para Leishmania. El segundo ciclo es doméstico, y en su transcurso Lu. trapidoi y Lu. reburra serían los vectores responsables de la translocación de Le. amazonensis del ciclo de transmisión silvestre al ciclo de transmisión doméstico, dado el mayor riesgo de endofagia en el peridomicilio.

Se ha señalado que el ciclo de Le. amazonensis en focos endémicos depende de las especies dominantes primarias o secundarias (21), pero para confirmar esta hipótesis es necesario evaluar en campo, entre otras variables ecológicas, la preferencia alimentaria, la tasa de picadura y la actividad nocturna. La presencia de ADN de Leishmania en el abdomen de una hembra evidenció que hubo multiplicación del parásito en el mesenterón, lo que desde el punto de vista biológico es clave cuando se evalúa el papel de una especie de flebotomíneos como vector local.

Por último, será necesario hacer seguimiento activo de los pacientes para la detección y la tipificación de Le. amazonensis, ya que no solo está implicada en los casos humanos de leishmaniasis cutánea en el Neotrópico, sino que se ha señalada como agente etiológico en algunos casos de leishmaniasis mucocutánea y, en especial, de leishmaniasis visceral atípica en humanos y caninos (45-49). En cuanto a los casos clínicos potencialmente asociados con Le. amazonensis, se esperaría una mayor incidencia en altitudes extremadamente altas o bajas, dado el alto porcentaje de positividad para Lu. trapidoi como vector primario.

Agradecimientos

A Orlando Chiluisa, Ernesto Villacrés y Katherine Pozo, estudiantes de Ciencias Biológicas y Ambiente de la UCE, por su colaboración en el trabajo de campo. A Franklin Vaca, por su apoyo técnico en campo. A Paúl Duque, por el diseño del mapa. A Gustavo Benaim y Graciela Uzcanga, del Instituto IDEA de Venezuela y la Universidad Internacional Sek de Ecuador, por facilitar la cepa de referencia MHOM/BZ/82/BEL21 de Leishmania mexicana.

Conflicto de intereses

No se declara ningún conflicto de intereses.

Financiación

El Centro de Investigación en Salud Pública y Zoonosis y el Instituto de Biomedicina de la Universidad Central del Ecuador, recibieron financiación de la Fundación para la Asistencia Médica Internacional de Portugal. El Programa PrometeoSenescyt  de Ecuador otorgó apoyo a Jazmín Arrivillaga Henríquez y a Alon Warburg. Ana Poveda recibió financiación para el proyecto #21 de la Dirección General de Investigación y Posgrado, Universidad Central del Ecuador y de la Academie de Recherche et d´Enseignement Supérieur (ARES) de Bélgica.

Correspondencia:

Jazmín Arrivillaga-Henríquez, Instituto de Investigación en Salud Pública y Zoonosis, Unidad de Entomología Aplicada, Universidad Central del Ecuador, Gatto Sobral y Jerónimo Leiton, Edificio Hospital del día, 3er piso, Quito, Ecuador

Teléfono: (593-02) 290 4801

jazzmin.arrivillaga@gmail.com y jcarrivillaga@edu.uce.ec

Referencias

1. Alexander JB, Takaoka H, Eshita Y, Gómez EA, Hashiguchi Y. New records of phlebotomine sad flies (Diptera: Psychodidae) from Ecuador. Mem Inst Oswaldo Cruz.1992;87:123-30. https://doi.org/10.1590/S0074-02761992000100019

2. LePont F, León R, Guerrini F, Gantier JC, Mouchet J, Echeverría R, et al. Leishmaniasis in Ecuador. 3. Lutzomyia trapidoi, vector of Leishmania panamensis. Ann Soc Belg Med Trop. 1994;74:23-8.

3. Jones LA, Cohnstaedt LW, Beati L, Terán R, León R, Munstermann LE. New records of phlebotomine sand flies (Diptera: Psychodidae) from Ecuador. Proc Entomol Soc Wash. 2010;112:47-53. https://doi.org/10.4289/0013-8797112.1.47

4. Araújo P, Bersosa F, Carranco R, Granda V, Guerra P, Miranda N, et al. Evaluación preliminar de la diversidad de escarabajos (Insecta: Coleoptera) del Chocó ecuatoriano. Revista Politécnica, Biología. 2005;26:120-40.

5. Instituto Nacional de Estadística y Censos. Estadística demográfica en el Ecuador. Quito: INEC; 2010. p. 300.

6. Calvopina M, Armijos RX, Hashiguchi Y. Epidemiology of leishmaniasis in Ecuador: Current status of knowledge -a review. Mem Inst Oswaldo Cruz. 2004;99:663-72. https://doi.org/10.1590/S0074-02762004000700001

7. Calvopiña M, Loor R, Lara F, Zambrano P, Hashiguchi Y. Prevalencia y formas clínicas de las leishmaniasis en el noroccidente de la provincia de Pichincha, Ecuador. Rev Fac Cien Med Quito. 2012;37:31-8.

8. Kato H, Uezato H, Gómez EA, Terayama Y, Calvopina M, Iwata H, et al. Establishment of a mass screening method of sand fly vectors for Leishmania infection by molecular biological methods. Am J Trop Med Hyg. 2007;77:324-9.

9. Santamaría E, Ponce N, Zipa Y, Ferro C. Presencia en el peridomicilio de vectores infectados con Leishmania (Viannia) panamensis en dos focos endémicos en el occidente de Boyacá, piedemonte del valle del Magdalena medio, Colombia. Biomédica. 2006;26:82-94. https://doi.org/10.7705/biomedica.v26i1.1503

10. Gómez EA, Kato H, Mimori T, Hashiguchi Y. Distribution of Lutzomyia ayacuchensis, the vector of Andean-type cutaneous leishmaniasis, at different altitudes on the Andean slope of Ecuador. Acta Trop. 2014;137:118-22. https://doi.org/10.1016/j.actatropica.2014.05.006

11. Kato H, Uezato H, Katakura K, Calvopiña M, Marco JD, Barroso PA, et al. Detection and identification of Leishmania species within naturally infected sand flies in the Andean areas of Ecuador by a polymerase chain reaction. Am J Trop Med Hyg. 2005;72:87-93.

12. Duque P, Vélez I, Morales M, Sierra D. Sand flies fauna involved in the transmission of cutaneous leishmaniasis in afro-Colombian and Amerindian communities of Chocó Pacific Coast of Colombia. Neotrop Entomol. 2004;33:25564. https://doi.org/10.1590/S1519-566X2004000200018

13. Gómez EA, Kato H, Hashiguchi Y. Man-biting sand fly species and natural infection with the Leishmania promastigote in leishmaniasis-endemic areas of Ecuador. Acta Trop. 2014;140:41-9. https://doi.org/10.1016/j.actatropica.2014.07.003

14. Young DG, Duncan M. Guide to the identification and geographic distribution of Lutzomyia sandflies in México, the West Indies, Central and South America (Diptera: Psychodidae). Gainesville, Florida: Associated Publishers;1994.

15. Ministerio del Ambiente de Ecuador. Línea base de deforestación del Ecuador Continental. Quito: Ministerio del Ambiente del Ecuador; 2012. p. 1-32.

16. Bejarano EE, Uribe S, Rojas W, Vélez ID. Phlebotomine sand flies (Diptera: Psychodidae) associated with the appearance of urban leishmaniasis in the city of Sincelejo, Colombia. Mem Inst Oswaldo Cruz. 2002;97:645-7. https://doi.org/10.1590/S0074-02762002000500010

17. Rebollar-Téllez E, Ramírez-Fraire A, Andrade-Narváez FJ. A two years study on vectors of cutaneous leishmaniasis. Evidence for sylvatic transmission cycle in the state of Campeche, México. Mem Inst Oswaldo Cruz. 1996;91:55560. https://doi.org/10.1590/S0074-02761996000500004

18. Rodrigues W, Medeiros J, Julião GR, Ríos-Velásquez CM, Marialvac EF, Desmouliérec S, et al. Anthropic effects on sand fly (Diptera: Psychodidae) abundance and diversity in an Amazonian rural settlement, Brazil. Acta Trop. 2014;139:44-52. https://doi.org/10.1016/j.actatropica.2014.06.017

19. Plisco P, Fuentes-Castillo T. Modelación de la distribución de especies y ecosistemas en el tiempo y en el espacio: una revisión de las nuevas herramientas y enfoques disponibles. Rev Geogr Norte Gd. 2011;48:61-79. https://doi.org/10.4067/S0718-34022011000100005

20. Quintana MG, Salomón OD, De Grosso MS. Distribution of phlebotomine sand flies (Diptera: Psychodidae) in a primary forest-crop interface, Salta, Argentina. J Med Entomol. 2010;47:1003-10.

21. Kato H, Gómez EA, Martini-Robles L, Muzzio J, Vélez L, Calvopiña M, et al. Geographic distribution of Leishmania species in Ecuador based on the cytochrome B gene sequence analysis. PLoS Negl Trop Dis. 2016;10:e0004844.https://doi.org/10.1371/journal.pntd.0004844

22. El Tai NO, El Fari M, Mauricio I, Miles MA, Oskam L, El Safi SH, et al. Leishmania donovani:Intraspecific polymorphisms of Sudanese isolates revealed by PCRbased analyses and DNA sequencing. Exp Parasitol. 2001;97:35-44. https://doi.org/10.1006/expr.2001.4592

23. Hijjawi N, Kanani KA, Rasheed M, Atoum M, AbdelDayem M, Irhimeh MR. Molecular diagnosis and identification of Leishmania species in Jordan from saved dry samples. Biomed Res Int. 2016;2016:6871739. https://doi.org/10.1155/2016/6871739

24. Freitas-Lidani KC, Messias-Reason IJ, Ishikawa EA. A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania) infantum. Mem Inst Oswaldo Cruz. 2014;109:442-7. https://doi.org/10.1590/0074-0276130285

25. Uzcanga G, Lara E, Gutiérrez, Beaty D, Beske T, Teran R, et al.Nuclear DNA replication and repair in parasites of the genus Leishmania exploting differences to develop innovative therapeutic approaches. Crit Rev Microbiol. 2017;43:156-77. https://doi.org/10.1080/1040841X.2016.1188758

26. Pommier Y. Drugging topoisomerases: Lessons and challenges. ACS Chem Biol. 2013;8:82-95. https://doi.org/10.1021/cb300648v

27. Villacís B, Carrillo D. Estadística demográfica en el Ecuador: diagnóstico y propuesta. Quito: Instituto Nacional de Estadística y Censos; 2011. p. 1-74.

28. Instituto Nacional de Meteorología e Hidrología. Anuario Meteorológico N° 52-2012. Quito: INMH; 2012. p. 132.

29. Golczer G, Arrivillaga J. Modificación de un protocolo estándar de extracción de ADN para flebotominos pequeños (Phlebotominae: Lutzomyia). Rev Col Entomol. 2008;34:199-202.

30. Echeverría-Fonseca G, Mera-Ruiz PA, Carrillo-Toro J, Rodríguez-Hidalgo R. A new DNA extraction protocol for screwworm fly Cochliomyia species (Diptera: Calliphoridae). Front Environ Sci. 2015;2:68. https://doi.org/10.3389/fenvs.2014.00068

31. Higgins DG, Bleasby AJ, Fuchs R. Clustal V improved software for multiple sequence alignment. Comp Appl Biosci. 1992;8:189-191.

32. Saito N, Nei M. The neighbor-joining method a new method for reconstructing phylogenetic trees. Mol Biol Evol.1987;4:406-25. https://doi.org/10.1093/oxfordjournals. molbev.a040454

33. Swofford DL. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version 4.0b10. Suderland, MA: Sinauer association Inc; 2001. http://benedick.rutgers.edu/software-manuals/PAUP4-manual.pdf

34. Arrivillaga JC, Norris D, Feliciangeli MD, Lanzaro G. Phylogeography of the neotropical sand fly Lutzomyia longipalpis inferred from mitochondrial DNA sequences. Infect Genet Evol. 2002;2:83-95. https://doi.org/10.1016/S1567-1348(02)00087-4

35. Arrivillaga J, Mutebi JP, Piñango H, Norris D, Alexander, B, Feliciangeli MD, et al. The taxonomic status of genetically divergent populations of Lutzomyia longipalpis (Diptera: Psychodidae) based on the distribution of mitochondrial and isozyme variation. J Med Entomol. 2003;40:615-27.

36. Logan-Klumpler FJ, De Silva N, Boehme U, Rogers MB, Velarde G, McQuillan J, et al. GeneDB-an annotation database for pathogens. Nucl Acids Res. 2012;40:98-108. https://doi.org/10.1093/nar/gkr1032

37. Paiva BR, Oliveira AG, Dorval MEMC, Galati EAB, Malafronte RS. Species-specific identification of Leishmania in naturally infected sand flies captured in Mato Grosso do Sul state, Brazil. Acta Trop. 2010;115:126-30. https://doi.org/10.1016/j.actatropica.2010.02.013

38. Figueroa-Roa L, Linhares A. Synanthropy of Muscidae (Diptera) in the city of Valdivia, Chile. Neotrop Entomol. 2004;33:647-51. https://doi.org/10.1590/S1519-566X2004000500016

39. SPSS, INC. Statistical Package for the Social Sciences. Version 15.0. Chicago, IL: SPSS; 2006.

40. Grimaldi G, Momen H, Naiff RD, McMahon-Pratt D, Barret TV. Characterization and classification of leishmanial parasite from humans, wild mammals, and sandflies in the Amazon region of Brazil. Am J Trop Med Hyg. 1981;44:64561. https://doi.org/10.4269/ajtmh.1991.44.645

41. Ferreira AL, Sessa PA, Malta-Varejao JP, Falqueto A. Distribution of sand flies (Diptera:Pshychodidae) at different altitudes in a endemic region of American cutaneous leishmaniasis in the state of Espírito Santo, Brazil. Mem Inst Oswaldo Cruz. 2001;96:1061-7. https://doi.org/10.1590/S0074-02762001000800006

42. Armijos RX, Chico M, Cruz M, Guderian R, Kreutzer R, Berman J, et al. Human cutaneous leishmaniasis in Ecuador: Identification of parasites by enzyme electrophoresis. Am J Trop Med Hyg.1990;42:424-8. https://doi.org/10.4269/ajtmh.1990.42.424

43. Bañuls AL, Guerrini F, Le Pont F, Barrera C, Espinel I, Guderian R, et al. Evidence for hybridization by multilocus enzyme electrophoresis and random amplified polymorphic DNA between Leishmania brasiliensis and L. panamensi/guyanensis in Ecuador. J Eukaryot Microbiol. 1997;44:40811.https://doi.org/10.1111/j.1550-7408.1997.tb05716.x

44. Hashiguchi Y, Gómez E, de Coronel VV, Mimori T, Kawabata M, Furuya M, et al. Andean leishmaniasis in Ecuador caused by infection with Leishmania mexicana and L. major-like parasites. Am J Trop Med Hyg. 1991;44:205-17.https://doi.org/10.4269/ajtmh.1991.44.205

45. Da Silva ACT, Cupolillo E, Volpini AC, Almeida R, Romero GA. Species diversity causing human cutaneous leishmaniasis in Rio Branco, State of Acre, Brazil. Trop Med Inter Health. 2006;11:1388-98. https://doi.org/10.1111/j.1365-3156.2006.01695.x

46. Jennings Y, Almeida A. Phenotypic characterization of Leishmania spp. causing cutaneous leishmaniasis in the lower Amazon region, western Pará state, Brazil, reveals a putative hybrid parasite, Leishmania. Parasite. 2014;21:111.https://doi.org/10.1051/parasite/2014039

47. Aleixo JA, Nascimento ET, Monteiro GR, Fernandes MZ, Ramos AM, Wilson ME, et al. Atypical American visceral leishmaniasis caused by disseminated Leishmania amazonensis infection presenting with hepatitis and adenopathy. Trans R Soc Trop Med Hyg. 2006;100:79-82. https://doi.org/10.1016/j.trstmh.2005.06.025

48. Tolezano JE, Uliana SR, Taniguchi HH, Araújo MF, Barbosa JA, Barbosa JE, et al. The first records of Leishmania (Leishmania) amazonensis in dogs (Canis familiaris) diagnosed clinically as having canine visceral leishmaniasis from Araçatuba county, São Paulo state, Brazil. Vet Parasitol. 2007;149:280-4. https://doi.org/10.1016/j.vetpar.2007.07.008

49. Hoffmann AR, Navarro IT, Camargo VE Jr, Caldart ET, Breganó RM, Pereira PM. Leishmania amazonensis in dog with clinical diagnosis of visceral leishmaniasis in Paraná state, Brazil - a case report. Semina: Ciências Agrárias. 2012;33:3265-70.

Métricas de artículo

Cargando métricas ...

Metrics powered by PLOS ALM




Revista Biomédica -  https://doi.org/10.7705/issn.0120-4157
ISSN 0120-4157

Instituto Nacional de Salud
INSTITUTO NACIONAL DE SALUD
Avenida Calle 26 No. 51-20
Apartado aéreo 80334 y 80080
Bogotá, D.C., Colombia, S.A.
Teléfono: 05712207700 Ext. 1386
Correo electrónico: biomedica@ins.gov.co